ID: 1158568922

View in Genome Browser
Species Human (GRCh38)
Location 18:58580061-58580083
Sequence CCATGGAATGCACTGTCTTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158568918_1158568922 -4 Left 1158568918 18:58580042-58580064 CCATCCGTGAACTTTGATGCCAT 0: 1
1: 0
2: 0
3: 2
4: 99
Right 1158568922 18:58580061-58580083 CCATGGAATGCACTGTCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 159
1158568915_1158568922 29 Left 1158568915 18:58580009-58580031 CCTTCATCATGAGGACCATCATT 0: 1
1: 0
2: 1
3: 51
4: 578
Right 1158568922 18:58580061-58580083 CCATGGAATGCACTGTCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 159
1158568920_1158568922 -8 Left 1158568920 18:58580046-58580068 CCGTGAACTTTGATGCCATGGAA 0: 1
1: 0
2: 1
3: 24
4: 262
Right 1158568922 18:58580061-58580083 CCATGGAATGCACTGTCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 159
1158568917_1158568922 14 Left 1158568917 18:58580024-58580046 CCATCATTGTTCAGGTCACCATC 0: 1
1: 0
2: 1
3: 25
4: 226
Right 1158568922 18:58580061-58580083 CCATGGAATGCACTGTCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158568922 Original CRISPR CCATGGAATGCACTGTCTTG TGG Exonic
901665563 1:10824310-10824332 CCATGGACTGAACTCTCCTGCGG + Intergenic
902577735 1:17389025-17389047 GCATGTATTGGACTGTCTTGGGG - Intronic
903265409 1:22155070-22155092 CCATGGAGTGCACAGGCTGGTGG + Intergenic
903378942 1:22883791-22883813 TCTTGGAATGCACTGCCTAGGGG - Intronic
903502993 1:23812145-23812167 TCATGGAGTGCACGGTCTAGTGG + Intronic
904033092 1:27545328-27545350 CAATGGAATGCATTGGTTTGAGG + Intronic
906362747 1:45177807-45177829 CCATAGAATGCATTGTATTAAGG - Intronic
907037770 1:51231450-51231472 CTATGGAAAGCACTGTGATGTGG + Intergenic
907159444 1:52359939-52359961 CCACGGACTTCACTGGCTTGAGG + Intronic
908791996 1:67791953-67791975 CCAAGCAATGCTCTGTCTTGGGG + Intronic
908915609 1:69122340-69122362 CCATGGTATGAACTGTCTGGTGG + Intergenic
911948928 1:104147550-104147572 TCATGGAATGCACTGTGCTCTGG + Intergenic
912690133 1:111798610-111798632 CCATGGACTGGACTGGCTTCTGG + Intronic
913698207 1:121348167-121348189 CAAGGGTAGGCACTGTCTTGGGG - Intronic
914139342 1:144931885-144931907 CAAGGGTAGGCACTGTCTTGGGG + Intronic
914257590 1:145973343-145973365 CAGTGGAATATACTGTCTTGGGG + Intronic
917363063 1:174198661-174198683 GCATGCATTGCACTGTATTGGGG + Intronic
920485606 1:206366823-206366845 CAAGGGTAGGCACTGTCTTGGGG - Intronic
920579480 1:207091987-207092009 CAATGGAATGTATTCTCTTGAGG - Intronic
923271893 1:232363037-232363059 CCATGTAATTTACTGTCTTGTGG + Intergenic
1064702709 10:18038129-18038151 ACATGGAATACAATGTCTTCAGG - Intronic
1067547140 10:47200762-47200784 CCATTGGATTCACAGTCTTGAGG - Intergenic
1071264492 10:83952844-83952866 CAAAAGAATGAACTGTCTTGGGG + Intergenic
1071308542 10:84321932-84321954 GAATGGAAAGCACAGTCTTGAGG + Intergenic
1072486076 10:95857160-95857182 CGATGGCATGTAGTGTCTTGGGG + Intronic
1073111879 10:101067376-101067398 CCCTGGAATGCGCTTTCTTCTGG + Intronic
1074541515 10:114369109-114369131 CCAAGGAAACCACTGTCATGAGG - Intronic
1074939129 10:118217573-118217595 CCATGGCAAGAACTGACTTGTGG + Intergenic
1074966241 10:118493240-118493262 CCATGGAGTCCACTGTCCTATGG + Intergenic
1075214340 10:120519107-120519129 CCACTGACTGCACTTTCTTGTGG + Intronic
1076734226 10:132451617-132451639 CCCTGGAATGCTGTGTTTTGGGG - Intergenic
1077868868 11:6244651-6244673 AGATGGAATGCACAGTCTTGGGG - Intergenic
1078205173 11:9222804-9222826 GCATGGAAAGCACGTTCTTGAGG - Intronic
1079580937 11:22064036-22064058 CCATGAAATGAACTAACTTGGGG + Intergenic
1080547660 11:33336941-33336963 TCAAGAAATGCACTGTCTAGTGG - Intronic
1085935547 11:81137513-81137535 CCAGGGAATGTTCTGTCTTAGGG - Intergenic
1088739792 11:112757835-112757857 CCATGAAGAGCAATGTCTTGGGG + Intergenic
1090417407 11:126550091-126550113 CCAAGGATACCACTGTCTTGCGG - Intronic
1090589487 11:128250280-128250302 CCATGGAGGGCACTGAGTTGGGG - Intergenic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1092910976 12:13144695-13144717 ACATCTACTGCACTGTCTTGAGG + Intergenic
1095412346 12:41937818-41937840 CCATGGAATTTAGTGTCTAGTGG - Intergenic
1097658636 12:62401303-62401325 CTATGGGATTCACTGTCTTAAGG + Intronic
1099300424 12:80887729-80887751 CCATGGAACTCACAGTCTAGTGG - Intronic
1102950715 12:117029242-117029264 CCATAGGGTGCAGTGTCTTGGGG - Intronic
1105863626 13:24439785-24439807 CCTTGGAGTGCATTGTTTTGGGG - Intronic
1105944819 13:25180202-25180224 AGAGGAAATGCACTGTCTTGCGG - Intergenic
1108962374 13:56250234-56250256 CCATGGAATAGTCTGTCTTCAGG - Intergenic
1110252745 13:73398958-73398980 ACATGGCATGCACTGTTTTTCGG - Intergenic
1110676537 13:78252976-78252998 CAATGGAGTGCTCTGTTTTGGGG + Intergenic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1114173431 14:20297289-20297311 ACATGGTCTGCACTGTCTTGTGG - Intronic
1114556427 14:23564984-23565006 TCATGGAGTTCACTGTCTAGAGG + Intronic
1114674479 14:24431216-24431238 CCAAGGAATGCACTGTGGGGTGG + Intronic
1115474709 14:33801420-33801442 CCATAGAATACTCAGTCTTGTGG + Intronic
1118017771 14:61677208-61677230 TGATGGATTGCTCTGTCTTGAGG + Intergenic
1118397086 14:65347026-65347048 CCATGGAGTGCACTGTCACGGGG + Intergenic
1122790754 14:104183212-104183234 ACGTGGAATCCACTGTCTTGGGG + Intergenic
1123634683 15:22292016-22292038 CCTTGGAATTCTCTGTCTTACGG + Intergenic
1123680491 15:22759556-22759578 TCATGGAAGGCACTGTCATATGG - Intergenic
1123744118 15:23305165-23305187 CCATGGAAGGCACTATCATATGG - Intergenic
1124332709 15:28834013-28834035 TCATGGAAGGCACTGTCATATGG - Intergenic
1127318905 15:57823632-57823654 CCATGGAAAGCAAGGCCTTGTGG - Intergenic
1127922956 15:63507689-63507711 CCATGGAAGGCACTGTGTGTTGG + Intronic
1129321123 15:74775602-74775624 TCTTGGAATGTTCTGTCTTGTGG - Intergenic
1129368535 15:75071996-75072018 CCATGGAATGTACTCTCTAGGGG + Intronic
1136633041 16:31500322-31500344 CCATGGAAAGCACAGGCTTCAGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1144247336 17:13380122-13380144 GCAAGGAATTCACTGTCTTTTGG - Intergenic
1144642365 17:16944650-16944672 CCATGGAGCTCACTGTCTCGTGG - Intronic
1146610546 17:34301226-34301248 CCAAGGAATGCCTTGTGTTGTGG - Intergenic
1152178020 17:78800578-78800600 CCATGGAAGCCACTGTGTGGGGG - Intronic
1153431752 18:5025043-5025065 CCATGGCATGCACAGGGTTGGGG - Intergenic
1154105081 18:11515662-11515684 CCACTCAATGCTCTGTCTTGAGG - Intergenic
1157329831 18:46695683-46695705 CCATGGTATTTACTGTCTAGTGG - Intronic
1157344413 18:46811575-46811597 CCATTGAATGAAATGTCTTTGGG - Exonic
1158568922 18:58580061-58580083 CCATGGAATGCACTGTCTTGTGG + Exonic
1160779653 19:872167-872189 CGATGGGATGAAGTGTCTTGGGG + Intronic
1161050426 19:2160991-2161013 TCATGGGATGCAGTCTCTTGGGG - Intronic
1161586150 19:5106932-5106954 CCCTGGATTGCCCTGCCTTGGGG - Intronic
1162248911 19:9426103-9426125 CAATGGAAGGCAGTGTCCTGGGG - Intronic
1162685373 19:12378557-12378579 CCATGGAAGGATCTGACTTGAGG - Intergenic
1163342755 19:16720231-16720253 TCATGGAATTCACTTTCTCGTGG + Exonic
1165139798 19:33691880-33691902 CCATGGCATGAACTGTCCTGGGG + Intronic
1166327616 19:42060907-42060929 CCATGTAATGCACTTATTTGTGG + Intronic
1167882569 19:52472632-52472654 CCATGGCATGCTCTATTTTGAGG + Intronic
926340802 2:11902920-11902942 CCCTGGGGTGCTCTGTCTTGGGG + Intergenic
926430477 2:12780341-12780363 CCAAGGAACTCACTGTCTAGAGG - Intergenic
926632896 2:15153419-15153441 CCATGCAATGCCCTCTCATGAGG - Intergenic
927505076 2:23607576-23607598 CCATGGACTGTACTGGTTTGTGG - Intronic
928409978 2:31047431-31047453 CCCTGGGATGCCCTGTCTTTTGG - Intronic
929248617 2:39729307-39729329 CCATGGAATCCACTTTCTGGGGG - Intergenic
933907670 2:86911406-86911428 CTCTGGAATTGACTGTCTTGAGG + Intronic
933908918 2:86921121-86921143 CTCTGGAATTGACTGTCTTGAGG + Intronic
934023807 2:87982264-87982286 CTCTGGAATTGACTGTCTTGAGG - Intergenic
935120152 2:100177154-100177176 CAATGGAATGAACTCTCTTTAGG + Intergenic
936364459 2:111839987-111840009 CTCTGGAATTGACTGTCTTGGGG - Intronic
937251710 2:120528066-120528088 TCATGGAATGCAGGGTCATGTGG + Intergenic
938070582 2:128306238-128306260 CCAGGGAAGGCACTGTCCTGTGG - Intronic
938332367 2:130456758-130456780 CCATGGTGTGCACTGCCTTTGGG - Intergenic
938562210 2:132483328-132483350 CCATGGAATGCCATGACTTCTGG + Intronic
938596256 2:132790158-132790180 CCTTGAAATGCCCTGGCTTGGGG - Exonic
940346870 2:152637464-152637486 CCATGGGAGCCTCTGTCTTGTGG + Intronic
941367375 2:164623829-164623851 CCAAGGAATACTCTTTCTTGAGG - Intergenic
1170692369 20:18627365-18627387 CCATGGAAGGCACTGCTTTTGGG - Intronic
1171345961 20:24466803-24466825 CCCTGCTATGCACTGTCTGGGGG - Intergenic
1173091384 20:39975275-39975297 CCATGGATTGCACAGTTCTGTGG + Intergenic
1175667528 20:60873082-60873104 CCATGGAAGGCAGTGCCATGGGG - Intergenic
1183989830 22:41590197-41590219 CCATGCAGTGCAGTGTCTAGTGG + Intergenic
1184991889 22:48175986-48176008 CAAAGGAATGCACTGGCTTTCGG - Intergenic
949530464 3:4950410-4950432 CCATAGAAGGCTCTGCCTTGGGG - Intergenic
949537911 3:5010082-5010104 CCTGGGAATGCCCTGTCATGAGG - Intergenic
954714960 3:52522368-52522390 CGATGGACTGCAGTGTCTGGAGG + Exonic
957347479 3:78980767-78980789 CCATGGACTGAAGTGTTTTGAGG - Intronic
958529645 3:95309887-95309909 CCAGGCAATGCACTGTCTGAGGG + Intergenic
961358601 3:126354045-126354067 ACATGGAGTGCACTGTCTCAGGG - Intronic
961627335 3:128273144-128273166 CCATGGAGTGCAGAGACTTGGGG + Intronic
962691846 3:137907240-137907262 CCATGGGTTGCACAGTTTTGTGG - Intergenic
963466496 3:145688718-145688740 CCAGGGGATGCACTGTCTGTGGG - Intergenic
963907373 3:150783761-150783783 CCAAGGAGGGCACTGTGTTGAGG - Intergenic
967533427 3:190575343-190575365 TCATGAAATTCACAGTCTTGGGG + Intronic
967990130 3:195124514-195124536 CCACGGAATTCACAGTCTAGAGG - Intronic
970666580 4:18343340-18343362 CCATGGATTGCACAGTTCTGTGG + Intergenic
974397430 4:61356340-61356362 ACATCAAATGCACTGTCTAGGGG + Intronic
977269034 4:94891990-94892012 ACATATAAAGCACTGTCTTGGGG + Intronic
978069970 4:104454847-104454869 CCATGGAATGAGCTATCTTGCGG + Intergenic
980788802 4:137591210-137591232 ACATGCAATGCAATGTATTGAGG + Intergenic
980885981 4:138762905-138762927 CTATGGAATGCACACTCTTTTGG + Intergenic
983461004 4:168026220-168026242 CCATGGAATGGGATGTCTTTTGG + Intergenic
985547055 5:515071-515093 CCATGGAAGGCTCTGCCTTAGGG - Intronic
985747423 5:1655111-1655133 CCATGGAATGCCATTTCCTGGGG - Intergenic
986391489 5:7291525-7291547 TCATGGAAGGCACTGTCATATGG - Intergenic
990276973 5:54207713-54207735 CCAGGGAACAAACTGTCTTGTGG - Intronic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
996901830 5:128551670-128551692 ACATGGAATGCAGTTTCTGGGGG + Intronic
997375070 5:133391921-133391943 CCATGGCAGGTACAGTCTTGTGG - Intronic
997657901 5:135568861-135568883 CCCTGGTATGCACTGTCTTCTGG + Intergenic
998428343 5:142048970-142048992 GCATGAAATGCTCTGCCTTGGGG + Intergenic
998559455 5:143157606-143157628 CCATGGAATGCTCTTTCAAGAGG - Intronic
1002812276 6:641938-641960 CTATGAAATCCACTGTTTTGTGG + Intronic
1003140040 6:3463765-3463787 CCAGAGAACTCACTGTCTTGAGG - Intergenic
1006917265 6:37602655-37602677 CCCTGGATTCCACTGTCCTGAGG + Intergenic
1007166285 6:39831189-39831211 CCATGGAATATACATTCTTGTGG + Intronic
1013603549 6:111727155-111727177 CTACAGAATCCACTGTCTTGGGG - Intronic
1014967437 6:127773151-127773173 CCCTGGAATGTACTTCCTTGGGG + Intronic
1017941443 6:159056776-159056798 CCATGGGATGCAGAGTCTTCAGG - Intergenic
1021384800 7:20016030-20016052 CCATGGACTGCACTGCTCTGAGG + Intergenic
1022208449 7:28185138-28185160 CCCAGCAATGCACAGTCTTGAGG + Intergenic
1022632390 7:32097598-32097620 CCATGGGATGCTTTGTCTGGTGG - Intronic
1024051836 7:45628571-45628593 CCATGGGATGTCCTGCCTTGGGG - Intronic
1032875309 7:136032251-136032273 CCATGGAATGGCCTCTGTTGGGG - Intergenic
1033999397 7:147393004-147393026 CCATGTCATACACTGTCTTCTGG - Intronic
1035042676 7:155941782-155941804 CCAAGGAGTGAACAGTCTTGTGG - Intergenic
1035691104 8:1560527-1560549 CCCTGGGCTGCATTGTCTTGGGG + Intronic
1035860962 8:3027257-3027279 CCAGGGAATGCAGTGTGCTGGGG - Intronic
1035965426 8:4186390-4186412 TCAGGGACTGGACTGTCTTGGGG - Intronic
1037779117 8:21855731-21855753 GCATGGAATGCACAGTCTGGTGG - Intergenic
1039139755 8:34373348-34373370 AAATGGCATCCACTGTCTTGTGG - Intergenic
1041349056 8:56930369-56930391 CCATGGATTGCACACTCTGGTGG - Intergenic
1044856366 8:96480132-96480154 CCATAGAATGCTGTGTGTTGGGG + Intergenic
1045868608 8:106899386-106899408 CTATGGAATACAATGTCATGTGG + Intergenic
1045934943 8:107668556-107668578 CCACGGAGTTTACTGTCTTGTGG + Intergenic
1047311280 8:123694471-123694493 CCATGTGGTGCACTGCCTTGGGG + Intronic
1047439308 8:124862338-124862360 TAATGGAATGTACTATCTTGAGG + Intergenic
1051833170 9:21303875-21303897 CCAAGGAATACAATGTCTGGAGG - Intergenic
1188392881 X:29642729-29642751 CCCTGGAATACACAATCTTGTGG - Intronic
1188538796 X:31226668-31226690 TCATGGTATGAATTGTCTTGCGG + Intronic
1190522169 X:51291566-51291588 CCATGCTATGCACTGTGTAGAGG - Intergenic
1192194625 X:69019910-69019932 CCATGGCAGGCACTGTCTCAAGG + Intergenic
1193313086 X:80030610-80030632 CCTTGGAATGCCCTGTCCAGAGG + Exonic
1195001960 X:100650672-100650694 CCATGGAATGCCATGTCCTAAGG + Intronic
1199411824 X:147533047-147533069 CCAAGGCATGCAATGTCTTCAGG - Intergenic
1199861007 X:151800593-151800615 CCATGGAATCCACAGTCCTGTGG + Intergenic
1199944915 X:152657677-152657699 CCATGGCTTCCACTGTCCTGGGG - Intergenic
1202306240 Y:23473908-23473930 CCTTGGAATTCTCTGTCTTACGG + Intergenic
1202564569 Y:26196681-26196703 CCTTGGAATTCTCTGTCTTACGG - Intergenic