ID: 1158571696

View in Genome Browser
Species Human (GRCh38)
Location 18:58601972-58601994
Sequence GGGGTGCTACTGCATCTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158571696_1158571699 -7 Left 1158571696 18:58601972-58601994 CCCGCCAGATGCAGTAGCACCCC 0: 1
1: 0
2: 1
3: 15
4: 178
Right 1158571699 18:58601988-58602010 GCACCCCACCCCCTCCTGTCAGG 0: 1
1: 0
2: 3
3: 36
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158571696 Original CRISPR GGGGTGCTACTGCATCTGGC GGG (reversed) Intronic
904043638 1:27598195-27598217 GGGCTGCTTCTGCAGCTGGCTGG - Intronic
905078805 1:35298503-35298525 GGGGTGCTGCTGAAACTTGCAGG + Intronic
905153499 1:35952422-35952444 GGTGAGCCACTGCATCCGGCCGG + Intronic
907526279 1:55056043-55056065 GTGGTGCTGCTGCCCCTGGCGGG + Exonic
907596090 1:55721274-55721296 GGAGTGCTATGGCATCTGGTGGG + Intergenic
909496289 1:76282745-76282767 TGTGAGCCACTGCATCTGGCTGG - Intronic
909657829 1:78050177-78050199 CGTGAGCTACTGCACCTGGCCGG + Intronic
912418978 1:109530805-109530827 GGGGTGCTACCGCAGCTGGAGGG - Intergenic
912700177 1:111872270-111872292 GTGGTGCTTCTGCTTCTTGCAGG - Intronic
914708053 1:150187688-150187710 GGAGTGCTACTGCATCAAGTGGG - Intergenic
915152121 1:153842118-153842140 TGTGTGCCACTGCACCTGGCTGG + Intronic
915774834 1:158471641-158471663 CGTGAGCTACTGCACCTGGCCGG + Intergenic
917385558 1:174470112-174470134 GGGCTACTACTGCATTTTGCAGG + Intronic
921064254 1:211611554-211611576 GAGGTGCAGCTGCCTCTGGCAGG - Intergenic
922177865 1:223211134-223211156 GGGGTACTATTGCATCTTGTGGG - Intergenic
922983670 1:229850131-229850153 AGGGAGCCACTGCACCTGGCTGG + Intergenic
923966734 1:239149375-239149397 GGTGAGCCACTGCGTCTGGCAGG + Intergenic
1064253448 10:13724682-13724704 CGGCTGCTACGTCATCTGGCTGG + Intronic
1067527822 10:47048841-47048863 GGGGGGTTACTGCAGCTGGCCGG + Intergenic
1069858153 10:71453095-71453117 GGGGTGCTGGTGGTTCTGGCTGG - Intronic
1069958625 10:72066905-72066927 GTGGTGCTTCTGCTTCTGGAGGG - Exonic
1071511287 10:86264148-86264170 GGGGTGGTACTGCAGCTGCTGGG - Intronic
1072529386 10:96304469-96304491 AGGCTGCTGCTGCCTCTGGCTGG - Exonic
1073435561 10:103513783-103513805 GGGGTGCGGATGAATCTGGCTGG + Intronic
1074463352 10:113659302-113659324 GGGGTATTATTGCATCTGGTGGG - Intronic
1074729861 10:116359553-116359575 AGGGTGCTACTGCATCTAGTGGG - Intronic
1074851218 10:117440972-117440994 TGGGAGCCACTGCATCTGGCAGG + Intergenic
1075092940 10:119453605-119453627 GGCGTGTTGCTGCATCTGGTGGG - Intronic
1075711039 10:124530625-124530647 GGGGTGGTGCGGCATCTGGGAGG - Intronic
1077803605 11:5567529-5567551 GGAGTGGTTCTGCATCTGGATGG - Intronic
1080744662 11:35097998-35098020 GGGGTGCTGCTGGCTTTGGCTGG - Intergenic
1082048575 11:47751470-47751492 GGAGTGCTACTGTATCTAGTGGG - Intronic
1083757681 11:64800450-64800472 GGGGTGGTAGGGCAGCTGGCAGG - Intronic
1084656573 11:70523148-70523170 GGTGTGCTTCTGCATCTGCCCGG + Intronic
1089359674 11:117877355-117877377 GGGGTGGTACTGCTCCTGGCAGG - Intronic
1092145605 12:6212559-6212581 GGGGTGCTAGTGCAGCTGGGGGG - Intronic
1093249420 12:16782621-16782643 GGGGTGCAACTGCTTCTTGATGG - Intergenic
1093870607 12:24286682-24286704 TGAGAGCCACTGCATCTGGCAGG + Intergenic
1095479039 12:42614538-42614560 AGGGTGCTACTTCATTTTGCTGG + Intergenic
1097153529 12:56996313-56996335 GGGGGGCTGCTGCAGCAGGCTGG - Exonic
1101513958 12:105417625-105417647 TGAGTGCTACTTGATCTGGCAGG - Intergenic
1101948282 12:109154718-109154740 GGGGTTCTGCTGCAGCCGGCGGG - Intronic
1104594182 12:130109063-130109085 GCTGGGCTACTTCATCTGGCTGG - Intergenic
1105214178 13:18274702-18274724 GGGGTGCTAATGTTTCTGGATGG - Intergenic
1106602811 13:31201453-31201475 GGGGAGCGACTGAATTTGGCTGG + Intronic
1108704565 13:52973587-52973609 GGGCTGCTCCTGCCTCTGTCTGG + Intergenic
1109954227 13:69544802-69544824 GGTGAGCCACTGCACCTGGCTGG - Intergenic
1114283358 14:21215969-21215991 GGTGTGCCACTGCATCCAGCTGG - Intronic
1114683577 14:24507106-24507128 GGGGTGCTACTGCAACAAGAGGG + Intronic
1118359532 14:65044379-65044401 TGGCTGCTACTCCTTCTGGCAGG + Exonic
1119222742 14:72922640-72922662 CGTGAGCCACTGCATCTGGCTGG - Intergenic
1119682624 14:76604306-76604328 AGGGGGCTAAGGCATCTGGCCGG + Intergenic
1123038770 14:105481946-105481968 GGGGTGCTGCTGTCCCTGGCGGG - Intergenic
1124123484 15:26912899-26912921 CGTGAGCCACTGCATCTGGCTGG - Intronic
1124196700 15:27637986-27638008 CGGGAGCCACTGCACCTGGCTGG - Intergenic
1125717031 15:41825194-41825216 GGGGTGCTATTTCAGGTGGCTGG + Exonic
1125906537 15:43398086-43398108 GGGAAGCCCCTGCATCTGGCTGG + Exonic
1129412883 15:75359580-75359602 GGGTTGCTACTGCAGCAGGAAGG - Intronic
1129540279 15:76342644-76342666 GGGGCGCTCCTGCTTCTGGGAGG - Intergenic
1131123577 15:89838868-89838890 GGGGAGCTCCTGGGTCTGGCTGG + Intronic
1131372432 15:91894105-91894127 AATGTGCTACTGCATCTGCCTGG - Intronic
1132511416 16:343730-343752 TGGGAGCCACTGCACCTGGCTGG - Intronic
1133467013 16:6037054-6037076 GGGGTGCAACTGTATTTGGTGGG + Intronic
1133924738 16:10183194-10183216 CGGGGGCTACTGCGTCTCGCCGG - Intergenic
1135589997 16:23698226-23698248 GGGGTCCAAATGCATGTGGCTGG - Intronic
1135868441 16:26126719-26126741 TGGGTGCCATGGCATCTGGCGGG + Intronic
1138446179 16:57065587-57065609 TGTGTGTTACTGCATCTGGGGGG - Intronic
1138697962 16:58833409-58833431 GGGGTCCTTCTGCGTCAGGCTGG - Intergenic
1141663147 16:85452572-85452594 GGGGTGCTGCTGCATCTCAAAGG + Intergenic
1142187640 16:88701990-88702012 GGGGTCCTGCTCCATCTGGGCGG + Intronic
1142753255 17:2000799-2000821 GGTGCGCCACTGCAGCTGGCAGG + Intronic
1144206950 17:12986226-12986248 GTGGTGCTACTGCATTTTCCAGG - Intronic
1146824210 17:36009260-36009282 GGGGCCCTAGTGCAGCTGGCTGG + Intergenic
1147331304 17:39700792-39700814 TGGTTGCTCCTGCTTCTGGCGGG + Intronic
1148864394 17:50620980-50621002 GGGCTGCCACACCATCTGGCTGG - Intronic
1149036684 17:52141988-52142010 GGGGAGATACTGCTGCTGGCTGG + Intronic
1149535241 17:57428549-57428571 TGTGTGCCACTGCTTCTGGCTGG + Intronic
1151881826 17:76900426-76900448 GAGGTGCTACTGGATTTGGATGG + Intronic
1154458650 18:14556079-14556101 CGTGAGCTACTGCACCTGGCTGG + Intergenic
1156369092 18:36456603-36456625 GGGGTACTACTGGATGGGGCTGG + Intronic
1157576059 18:48744255-48744277 GGGGTCCTGCTGCACCTAGCAGG - Intronic
1158571696 18:58601972-58601994 GGGGTGCTACTGCATCTGGCGGG - Intronic
1159461574 18:68727611-68727633 TGGCTGCTACTGCTACTGGCAGG + Intronic
1160282006 18:77499539-77499561 GGGGTCCTACTGTATATGGGTGG - Intergenic
1161448120 19:4329244-4329266 CGTGAGCCACTGCATCTGGCCGG + Intronic
1162218140 19:9153442-9153464 TGGGAGCCACTGCACCTGGCTGG + Intronic
1162580091 19:11524199-11524221 GGTGAGCCACTGCACCTGGCTGG + Intronic
1162729552 19:12710143-12710165 GGGTTACTACTGACTCTGGCAGG + Intronic
1164776527 19:30857557-30857579 AGGGTGCTGCTGCCTCTGGGTGG + Intergenic
1164851412 19:31487314-31487336 CCGGAGCCACTGCATCTGGCTGG + Intergenic
1165023951 19:32945824-32945846 GGGGAGGTACTGCATGTTGCTGG - Intronic
1165749394 19:38251094-38251116 GGAGTGATTCTCCATCTGGCAGG + Intronic
1166700295 19:44878288-44878310 CTGGTGCTGCTGCTTCTGGCTGG + Intronic
1167098587 19:47390012-47390034 TGGCTGCTACAGCAACTGGCAGG - Intergenic
925110260 2:1329499-1329521 GGGGTGCAGCTGTATCTGTCAGG + Intronic
926128934 2:10288467-10288489 GGTGAGCCACTGCACCTGGCCGG + Intergenic
926715384 2:15920024-15920046 GGGGTCCTTCAGCCTCTGGCAGG + Intergenic
934300141 2:91772048-91772070 GGGGTGCTAATGTTTCTGGATGG + Intergenic
938714896 2:134010204-134010226 TGGCTGCTTCTGCATCTGGTGGG - Intergenic
944070846 2:195666741-195666763 TGTGAGCCACTGCATCTGGCTGG + Intronic
944450892 2:199841238-199841260 TGTGAGCCACTGCATCTGGCTGG - Intronic
944471266 2:200055672-200055694 GGGGTTCTACTGCTACTGGGAGG - Intergenic
944899345 2:204198481-204198503 GGGGTTCTACTTTTTCTGGCTGG - Intergenic
945227597 2:207548208-207548230 TGTGAGCCACTGCATCTGGCTGG + Intronic
946097441 2:217287673-217287695 GGGGTTCAAGTGCTTCTGGCCGG - Intronic
946447121 2:219749482-219749504 GGCTTGCTACTGCATCTGTGGGG + Intergenic
948106914 2:235421732-235421754 GGGCTGCTACTGGATCTGCCTGG - Intergenic
948841853 2:240654912-240654934 GGGTAGATACTGCATCTGGCTGG + Intergenic
1171934204 20:31258001-31258023 GGGTTGCTTCTGCATATGGAAGG - Intronic
1179080630 21:38167352-38167374 GGGGTGATTTTGCATTTGGCAGG + Intronic
1179959594 21:44760620-44760642 TGGGTGCTGCTGCATTTGCCCGG + Intergenic
1180041737 21:45283709-45283731 AGCGTGCAACTGCAGCTGGCGGG + Intronic
1180136712 21:45866753-45866775 GGGGTGCTGGAGCCTCTGGCAGG - Intronic
1181174223 22:21026868-21026890 GGGCTCCGACTGCATGTGGCAGG + Exonic
1181555881 22:23671475-23671497 GGGGTGCTAATGTTTCTGGATGG - Intergenic
1181643392 22:24216725-24216747 GGAGTGCTACTGCATCACACAGG + Intergenic
1181698496 22:24607178-24607200 GGGGTGCTAATGTTTCTGGATGG + Intronic
1182441567 22:30367518-30367540 CGTGAGCTACTGCACCTGGCTGG + Intronic
1182863532 22:33582135-33582157 GGGGTGCTACTGGATCCAGGGGG + Intronic
1183191981 22:36327517-36327539 GGGAGGCTTTTGCATCTGGCGGG - Intronic
1183693262 22:39403440-39403462 GGGGTGCTGGTGCAGCTGGGTGG + Intronic
1184451293 22:44584281-44584303 AGGGTGCTAGTGGAGCTGGCAGG - Intergenic
1185313600 22:50169821-50169843 GGGGTGCTGCGGCCACTGGCGGG - Intergenic
951087276 3:18528147-18528169 GGGGTGGTACTGCATAAGTCAGG - Intergenic
951205582 3:19922983-19923005 TGTGAGCCACTGCATCTGGCTGG - Intronic
951940911 3:28077917-28077939 GTGTTGCTGCTGCATTTGGCAGG - Intergenic
952444885 3:33371450-33371472 TGTGAGCCACTGCATCTGGCCGG + Intronic
953534196 3:43765001-43765023 TGGGTGGTGCTGCATCTGGAAGG + Intergenic
954373493 3:50182550-50182572 GGGGTGTTCTTGCACCTGGCTGG + Intronic
954791640 3:53137462-53137484 GTGGTGCTGCTGCATCTGACAGG - Intergenic
955287360 3:57655312-57655334 CGTGAGCCACTGCATCTGGCGGG + Intronic
955357255 3:58241349-58241371 GGGGTGTTGCTGCCTGTGGCTGG + Intronic
958019761 3:87980980-87981002 GGGCTGCTGCTGCACCTGGGGGG + Intergenic
959560026 3:107768874-107768896 CATGTGCCACTGCATCTGGCTGG - Intronic
961436225 3:126919593-126919615 CAGGAGCCACTGCATCTGGCTGG + Intronic
966830193 3:184001566-184001588 GGGGTGCTACTAGCTCTAGCAGG + Intronic
968728437 4:2258931-2258953 GGTGTGCCACAGCATCTGCCTGG + Intronic
972699079 4:41476470-41476492 TGGCTGCTGCTGCCTCTGGCGGG + Intronic
973213980 4:47648532-47648554 GGGGGGGTACTGCCTCTGTCAGG - Intronic
983317999 4:166156849-166156871 GGTGAGCCACTGCACCTGGCCGG - Intergenic
987138586 5:14922321-14922343 GGGGTGCTACTGGAGCTGAGGGG + Intergenic
992711257 5:79459594-79459616 AGGATGTTACTGCATCTGACAGG + Intronic
993391664 5:87325946-87325968 GGGGGGCTGCTGCATATTGCTGG - Intronic
998156441 5:139789395-139789417 GGTGTGTGACTGCAGCTGGCTGG - Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1002069050 5:176668057-176668079 GGGTACCTACTGCATCTGCCTGG + Intergenic
1002149185 5:177212908-177212930 CGTGAGCCACTGCATCTGGCTGG + Intronic
1002182209 5:177436442-177436464 GGGGTGCTCCTTCACCTCGCGGG - Exonic
1003428387 6:6014976-6014998 GTGGAGCCACTGCATCTGGCTGG + Intergenic
1004362513 6:14983852-14983874 GGGGAGCTACACCAACTGGCTGG - Intergenic
1006038543 6:31234026-31234048 GTGGTGCTACTGGCTGTGGCGGG + Intergenic
1006612381 6:35302006-35302028 CGTGAGCTACTGCACCTGGCTGG + Intronic
1006733891 6:36258104-36258126 TGTGAGCCACTGCATCTGGCTGG + Intronic
1006911385 6:37565873-37565895 GGGGTGCATCTGCCTATGGCGGG + Intergenic
1007688079 6:43679220-43679242 GGAGTGCTACTGCATCTAGCAGG + Intronic
1008384720 6:50875737-50875759 AGTGTGCTCATGCATCTGGCTGG + Intergenic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1012041480 6:94210274-94210296 TGTGAGCTACTGCACCTGGCTGG - Intergenic
1014573928 6:123046376-123046398 CGTGAGCTACTGCACCTGGCCGG - Intronic
1014599539 6:123392754-123392776 GGGGTGATTCTGCATGTTGCTGG + Intronic
1018177765 6:161192430-161192452 GGTGAGCCACTGCACCTGGCTGG + Intronic
1023468895 7:40491499-40491521 GGGATGCTAATGCATCTGAATGG + Intronic
1023530249 7:41146026-41146048 GGGTAAATACTGCATCTGGCTGG - Intergenic
1025248226 7:57334039-57334061 GGCATGCTACTGCATCTAGATGG + Intergenic
1029012199 7:97273692-97273714 GGTGTGCAGCTGCATCTGACAGG + Intergenic
1029325933 7:99808799-99808821 TGTGAGCTACTGCACCTGGCCGG + Intergenic
1030585516 7:111413948-111413970 GAGGTGCTGCTGCAACTTGCTGG - Intronic
1030585520 7:111413984-111414006 GGGATGCTAGTGGAACTGGCTGG - Intronic
1030801412 7:113857018-113857040 GAGCTCCCACTGCATCTGGCGGG + Intergenic
1031235912 7:119176076-119176098 GGGAAGCTACTGGAACTGGCTGG + Intergenic
1032197876 7:129799700-129799722 GGGCTGCTTCTGCATCCTGCTGG - Intergenic
1032416187 7:131737254-131737276 TGGTTGATATTGCATCTGGCTGG + Intergenic
1034612242 7:152381375-152381397 GGTGTGCTACTATATCTAGCGGG + Intronic
1035103166 7:156417796-156417818 CGTGAGCCACTGCATCTGGCCGG - Intergenic
1037945935 8:22989491-22989513 GGGGTGCTTGTGGATGTGGCAGG + Intronic
1039505318 8:38047887-38047909 TGTGTGCCACTGCACCTGGCTGG - Intronic
1041009703 8:53529728-53529750 TAGGTGCTGCTGCATCTGCCTGG + Intergenic
1043098618 8:76010014-76010036 GGTGAGCCACTGCATCTGACCGG - Intergenic
1046299513 8:112269005-112269027 GGGGTGCTTTTGGATCTAGCAGG - Intronic
1052407532 9:28081174-28081196 AAGGTGCTACTGCATCTAGTGGG - Intronic
1055494970 9:76844880-76844902 TGCGAGCTACTGCACCTGGCTGG - Intronic
1058675345 9:107395506-107395528 CGTGAGCCACTGCATCTGGCCGG - Intergenic
1060149478 9:121279166-121279188 AGAGTGCCATTGCATCTGGCTGG + Intronic
1060596175 9:124850496-124850518 GGTGAGCCACTGCATCTGGCTGG + Intergenic
1062523483 9:136969165-136969187 GGGGTGGGGCTGCATCTGGGAGG + Intergenic
1062613051 9:137383540-137383562 TGGGTGCTGCCGCAGCTGGCAGG - Intronic
1203775150 EBV:68767-68789 GGGGTGCTTCTGCTTCTGCCTGG - Intergenic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1189364821 X:40380345-40380367 GGGCTGCTGCCGCATCTGGAGGG + Intergenic
1191117699 X:56868601-56868623 GTGCTGCTGCAGCATCTGGCTGG + Intergenic
1193642630 X:84029634-84029656 GGGGTTCCAATACATCTGGCAGG + Intergenic
1193707092 X:84834106-84834128 CGTGAGCTACTGCACCTGGCAGG + Intergenic
1195629586 X:107040974-107040996 CGTGAGCCACTGCATCTGGCTGG + Intergenic
1198833322 X:140774884-140774906 GGGCTGCTACTGTACTTGGCTGG + Intergenic
1201920563 Y:19229342-19229364 GTGGTGCTATTGCAGCTTGCTGG - Intergenic