ID: 1158572900

View in Genome Browser
Species Human (GRCh38)
Location 18:58611912-58611934
Sequence GCTCACTGCACGCTGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158572893_1158572900 -2 Left 1158572893 18:58611891-58611913 CCACAGGGTGCCGCCCTGGCAGC 0: 1
1: 1
2: 1
3: 20
4: 221
Right 1158572900 18:58611912-58611934 GCTCACTGCACGCTGGAGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 165
1158572891_1158572900 5 Left 1158572891 18:58611884-58611906 CCAGAAACCACAGGGTGCCGCCC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1158572900 18:58611912-58611934 GCTCACTGCACGCTGGAGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 165
1158572888_1158572900 19 Left 1158572888 18:58611870-58611892 CCTTCTTAGGAATTCCAGAAACC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1158572900 18:58611912-58611934 GCTCACTGCACGCTGGAGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158572900 Original CRISPR GCTCACTGCACGCTGGAGGG TGG Intronic
901222376 1:7590524-7590546 GCTGCCTGCACCTTGGAGGGTGG + Intronic
902173491 1:14631667-14631689 TCACACTGCATGCTGGAGAGAGG + Intronic
902728269 1:18351542-18351564 GCCCACTGCTCTCTGGGGGGAGG + Intronic
906218466 1:44058758-44058780 GCTCACTGCAAGCTCCAGGGAGG + Intergenic
912520890 1:110243890-110243912 GCTCATTTCACTCTGGAGGCAGG + Intronic
914391548 1:147227983-147228005 GCTCACTGCAAGCTCCATGGAGG + Intronic
918296249 1:183160159-183160181 GCTCACTGCATGATGAAGGCGGG + Intergenic
921055022 1:211536938-211536960 GCTCCCTGGAGGCTGGAGGCTGG + Intergenic
1063370697 10:5520753-5520775 GCTTACTGGAGGGTGGAGGGTGG - Intergenic
1070534064 10:77362130-77362152 GCTCCCAGCAGGCTGGAGGAGGG + Intronic
1070819477 10:79346656-79346678 CCTCACTGCAAGGTGGTGGGAGG - Intergenic
1071240363 10:83698390-83698412 GCTCACTGTAGGCAGGAGGCTGG + Intergenic
1074353384 10:112759594-112759616 GCTCTCTGCAAGCTGGAGACTGG - Intronic
1076213761 10:128675540-128675562 GCTCACTGCACACTGCAGGCAGG - Intergenic
1077340317 11:2023473-2023495 CTTCACTCCACCCTGGAGGGAGG - Intergenic
1078531870 11:12142874-12142896 GCTCTCTGCACACAGAAGGGAGG + Intronic
1078846047 11:15119298-15119320 GCCCACTGCATGTTGGTGGGGGG - Intronic
1080403509 11:31958253-31958275 GCGGGCTGCACGCTGGAGGTGGG - Intronic
1080645624 11:34185662-34185684 GGTCACTGGAGGCTGGAGTGGGG + Intronic
1083852712 11:65377397-65377419 GCTCACTGCCGGCTTTAGGGAGG - Intronic
1086909813 11:92459211-92459233 TCTCACAGCACACTGAAGGGTGG - Intronic
1087300837 11:96433040-96433062 GCTTACTGCAAGGTGGAGGGTGG + Intronic
1090263935 11:125342425-125342447 GCTCACTGGGAGCTGGGGGGAGG - Intronic
1202823302 11_KI270721v1_random:78662-78684 CTTCACTCCACCCTGGAGGGAGG - Intergenic
1091677710 12:2503490-2503512 GCTCACCACTGGCTGGAGGGTGG - Intronic
1092112365 12:5972682-5972704 GCTCACTGCACACTGCTGGGAGG - Intronic
1092370930 12:7916034-7916056 GCTCAGTGCTCGCTGGGGGCAGG + Intergenic
1092525253 12:9305869-9305891 GCCCACTGCACCAAGGAGGGTGG - Intergenic
1092542019 12:9425948-9425970 GCCCACTGCACCAAGGAGGGTGG + Intergenic
1095705113 12:45228670-45228692 GCTCACTGTTCGCTAGTGGGAGG + Intronic
1098045801 12:66399199-66399221 GCTCCTGGCACGGTGGAGGGAGG - Intronic
1104108934 12:125688126-125688148 GCTCTCTGCACTCTGTGGGGTGG + Intergenic
1104738801 12:131157591-131157613 ACTCACTGCACTCTGGAGAGGGG + Intergenic
1111738863 13:92176696-92176718 GCTCCAGGCACTCTGGAGGGAGG - Intronic
1113313746 13:109157394-109157416 GCTGACTGCACTCGTGAGGGAGG - Intronic
1113727782 13:112618049-112618071 GGTCACTGGGCCCTGGAGGGAGG - Intergenic
1116336775 14:43666468-43666490 GCTCACTACACTCTGATGGGTGG - Intergenic
1119759530 14:77141111-77141133 GCGCAGTGCACGCCTGAGGGTGG + Intronic
1121006657 14:90495137-90495159 GGTCACTGCACACTGGAATGTGG + Intergenic
1121087568 14:91158119-91158141 GGTCACTGCACACTGCAGAGAGG - Intronic
1121459705 14:94065493-94065515 GATCACTGCAGACAGGAGGGAGG + Intronic
1121557993 14:94852738-94852760 GATCTCTGTATGCTGGAGGGTGG - Intergenic
1122163268 14:99802110-99802132 GCTCACTGCAGGCGGGTAGGTGG + Intronic
1122792754 14:104191280-104191302 GCTCCCTGCACAGTGGAGGTGGG + Intergenic
1124155017 15:27218094-27218116 GATCACTTGAGGCTGGAGGGTGG - Intronic
1124655385 15:31502999-31503021 GGCAGCTGCACGCTGGAGGGAGG + Intronic
1128386218 15:67150507-67150529 GCAGACTGCACGCTTGGGGGTGG - Intronic
1129393497 15:75232347-75232369 GCCACCTGCACGCTGGAGGAGGG + Intergenic
1129599462 15:76989857-76989879 GCTGACACCAAGCTGGAGGGCGG - Intergenic
1132858861 16:2060201-2060223 GCTCACAGCTCCCTGGAGGGTGG + Intronic
1133407559 16:5537498-5537520 CCTTACTGGAGGCTGGAGGGGGG + Intergenic
1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG + Exonic
1134308795 16:13057465-13057487 GCTCACTGCAATCTCCAGGGAGG + Intronic
1139702309 16:68715566-68715588 ACTCCCTGCAGGCTGGAGTGGGG - Intronic
1141518385 16:84561578-84561600 GCTCCCTGCAGGCTGGAGGAAGG - Intergenic
1141560215 16:84862890-84862912 GCTGACTGCCCGCTGGGGAGAGG + Intronic
1142135913 16:88452014-88452036 GCTCCCAGCAGGCTGGCGGGTGG + Intergenic
1142217719 16:88838015-88838037 GTTCCCTGCACGGTGAAGGGTGG + Intronic
1145973279 17:28969537-28969559 GCTCTCTGCAGGGTGGTGGGTGG + Intronic
1146315541 17:31804053-31804075 CCTCACTGCAACCTGGAGGTAGG + Intergenic
1146689736 17:34865150-34865172 GATCACTCCACTCTGGAGGTGGG + Intergenic
1147425276 17:40343202-40343224 CTTCACAGCAGGCTGGAGGGTGG + Intronic
1147624655 17:41892253-41892275 GATCACTGGGCTCTGGAGGGTGG - Intronic
1147970787 17:44218539-44218561 GCTCGCTGCACGCGGGAGCTAGG - Intronic
1148491348 17:48025699-48025721 GCTCTCTGCAAGCTTGCGGGTGG - Intergenic
1151456055 17:74226433-74226455 GACCACTGCACGTGGGAGGGGGG + Intronic
1151996245 17:77611102-77611124 GCTCCCTTCTCGGTGGAGGGAGG - Intergenic
1152329244 17:79662157-79662179 ACTCACTCCAGGCTGGAGTGCGG + Intergenic
1152406431 17:80100759-80100781 GCTCGCTGCAAGCTGGAAAGGGG + Intergenic
1152847573 17:82611445-82611467 TCTCACTCCAGGCTGGAGTGTGG - Intronic
1153543783 18:6185468-6185490 CCTCACTGCAGGCTGCAGGCTGG + Intronic
1156020437 18:32594158-32594180 GCTCCCTGCCAGCTGGAGGATGG - Intergenic
1156456137 18:37295517-37295539 GCTCAGAGCATGCTGGAGGCAGG + Intronic
1158095865 18:53770076-53770098 GCCTACTGGAGGCTGGAGGGTGG + Intergenic
1158572900 18:58611912-58611934 GCTCACTGCACGCTGGAGGGTGG + Intronic
1160317496 18:77860735-77860757 GCTCTCTGCAGGCTGGACGGAGG + Intergenic
1160948867 19:1656170-1656192 GCTCAGTGGACGCCGGAGCGAGG - Intergenic
1160990644 19:1859017-1859039 GCTCTCTGCACTCTGCAGGCTGG + Intronic
1161883324 19:6973072-6973094 GCTCAGTGGAAGCTGGAGGCAGG - Intergenic
1161953889 19:7482412-7482434 GCTCAGTGCCCCTTGGAGGGAGG + Intronic
1163050474 19:14679578-14679600 CCTGACTGCACGGTGGAGGATGG - Intronic
1166297575 19:41896517-41896539 GCTTACTGGGCGCTGGTGGGTGG + Intronic
1167190764 19:47987736-47987758 GCTCACAGCACTTTGGAAGGCGG + Intronic
1167289950 19:48619058-48619080 GCTAGGGGCACGCTGGAGGGCGG - Intronic
1168249091 19:55131134-55131156 GCTCACTGCAAGCTGGAGGCAGG - Intergenic
925906947 2:8545341-8545363 GGGCACTGCAGGCTGGAGGTTGG + Intergenic
927095691 2:19746181-19746203 GCTCCCAGCACACTGGAGGGTGG + Intergenic
929336143 2:40748414-40748436 GCTCACTGCAAGCTCAAGGCGGG - Intergenic
930025530 2:47027066-47027088 ACTTACGGCAGGCTGGAGGGTGG - Intronic
931808706 2:65833352-65833374 TCTCACTCCACACTGGAGGAAGG - Intergenic
932214707 2:69959174-69959196 GCTCATTCCACCCTGGAGGATGG + Intergenic
932425503 2:71631841-71631863 CCTCGCTGCACACTGCAGGGGGG + Intronic
934720594 2:96573065-96573087 GCTAACTGCAGGGTGGAGGATGG + Intergenic
936450000 2:112626776-112626798 CCTCACTGCCCACTGCAGGGTGG + Intergenic
937095927 2:119235124-119235146 GCCCACTGCAGGCTGGGGAGAGG - Intronic
939214632 2:139219992-139220014 GGTCACTGAGCCCTGGAGGGAGG - Intergenic
942450692 2:176106655-176106677 GCTCCCTGCGCCCTGGAGAGTGG + Intronic
943389889 2:187252314-187252336 GCTCACTGCAAGCAGGAAAGAGG + Intergenic
945293440 2:208147430-208147452 GCTCACTGCCAGCAGTAGGGTGG + Intergenic
948424029 2:237876654-237876676 GCTCACTGCTGGCTGGGTGGGGG - Intronic
948563305 2:238867961-238867983 CCTCACTACATGCAGGAGGGTGG - Intronic
949049225 2:241888358-241888380 GCTCAGGTCAGGCTGGAGGGTGG + Intergenic
1172135071 20:32681308-32681330 GCTGACAGCAGGCTGGAGAGGGG + Intergenic
1174336709 20:49867412-49867434 GCTCACTCCACTCTGGCTGGTGG + Intronic
1174488403 20:50875294-50875316 GCTCACTGTGCGCTGGCTGGCGG - Intronic
1175774738 20:61646028-61646050 GCTCACTGCATGCTGGGGCTGGG - Intronic
1178590008 21:33901930-33901952 CCTCACTGCAGGCAGGAGGCAGG + Intronic
1179248673 21:39655408-39655430 GCTCCCTGCCCACTGGAGGTGGG - Intronic
1179486527 21:41714079-41714101 GCTCATTCCACGCTGGAGGGAGG - Intergenic
1181710084 22:24679187-24679209 ACCTACTGCACGCTGGAGGCTGG + Intergenic
1181837645 22:25624054-25624076 GCTGACTGCACCCTGCAGTGGGG - Intronic
1183466135 22:37981308-37981330 GCTCCCTGGACCCTGGAGGGGGG - Intronic
1184135888 22:42549721-42549743 TCTCACCGCCTGCTGGAGGGAGG - Intergenic
1184783221 22:46659355-46659377 GCTAAGTGGAGGCTGGAGGGAGG - Intronic
1184893704 22:47394736-47394758 GCTCTCTGCAGGCTCTAGGGGGG - Intergenic
1185072838 22:48666778-48666800 TCTCCCAGCAGGCTGGAGGGAGG - Intronic
951915186 3:27793184-27793206 GCTCCCAGCACCCTGGTGGGAGG + Intergenic
954541490 3:51395730-51395752 GCTCACTGCAGGCTGTGGAGAGG + Exonic
956517481 3:70065368-70065390 CGTCACTGCACGCAGGCGGGTGG - Intergenic
959000741 3:100961371-100961393 GCTCACTGCAGAGTGGAGTGAGG + Intronic
960677095 3:120205662-120205684 GCTCACTGCCTGGTGGAGGTGGG - Intronic
962329835 3:134467823-134467845 CCTCACTGCATGCTGGAGCCTGG - Intergenic
962671894 3:137716715-137716737 GCTCACTGGAGGGTGGAGAGTGG - Intergenic
962712557 3:138100155-138100177 CCTCCCTGGAGGCTGGAGGGTGG - Intronic
964774938 3:160264903-160264925 GCTCACTGCAGGGTAGAGGTTGG - Intronic
967245759 3:187484757-187484779 GCCCACTACATCCTGGAGGGAGG + Intergenic
969437704 4:7198265-7198287 GGTCTCTGCACTCTGGAGGCTGG - Intronic
969673367 4:8601793-8601815 GCTCACTGCACCCTGGGCGGGGG - Intronic
969847474 4:9930603-9930625 GCTCACAGCATGCTGGATGAAGG + Intronic
969964893 4:10984053-10984075 GTTCTCTGCAGCCTGGAGGGTGG - Intergenic
972381969 4:38527538-38527560 GCTCATTGCACAGGGGAGGGTGG - Intergenic
973709401 4:53613509-53613531 GCTTACTGGACGGTGGGGGGTGG - Intronic
975144114 4:70948879-70948901 GCTCAGAGCATGGTGGAGGGAGG - Intronic
980030152 4:127818724-127818746 GCTTACTGGAAGGTGGAGGGTGG + Intronic
981073564 4:140569166-140569188 GCACACCGCACGTCGGAGGGAGG + Intergenic
981979279 4:150771822-150771844 GCTCACTGGGCACTGGTGGGCGG + Intronic
985635493 5:1033820-1033842 ACTCTCTGCCCGCTGGAGGCAGG + Intronic
986731614 5:10638569-10638591 GGTCACTGCTTGCTGGTGGGTGG + Intronic
988961082 5:36372516-36372538 GCTCACTGTAAGCTGGTGGCAGG - Intergenic
990425620 5:55685781-55685803 GCTTACTGGAAGGTGGAGGGTGG - Intronic
994358947 5:98828135-98828157 GGTCACTGCACTCTGATGGGTGG - Intergenic
996990799 5:129628293-129628315 GCCTACTGAAGGCTGGAGGGTGG + Intronic
997041625 5:130263121-130263143 GCTTACTGAAGGGTGGAGGGTGG - Intergenic
997463785 5:134072991-134073013 GCTCACTGCACGGGGGTGGGCGG + Intergenic
999405301 5:151301656-151301678 GCTCACTGCAAGCTCGAGACCGG - Intronic
1002602917 5:180364245-180364267 GCACACTGCACGGTGGAGGTGGG + Intergenic
1003582782 6:7357371-7357393 CCTCACTACATCCTGGAGGGGGG + Intronic
1004643694 6:17539559-17539581 TCTCCCTGCATGCTGGAGGCAGG - Intronic
1004910216 6:20275864-20275886 GCTTACTGAAGGGTGGAGGGTGG - Intergenic
1005849775 6:29812909-29812931 ACTCACTGCACAATGGATGGTGG - Intergenic
1007384046 6:41508677-41508699 GATCCCTGGAGGCTGGAGGGAGG - Intergenic
1009937740 6:70253492-70253514 GCCCACTGCACACTGCAGGGAGG + Intronic
1010445269 6:75942431-75942453 GCTTACTACATGCTGGAGGATGG + Intronic
1014442529 6:121490011-121490033 GCTCACTGCAAGCTCGAGGCAGG - Intergenic
1017819607 6:158039751-158039773 GCTCCCTGCACCCTGGGGCGAGG - Intronic
1021921001 7:25484709-25484731 GCTTACTGCAGGGTGGAGGGTGG + Intergenic
1023168472 7:37366711-37366733 GCTCACTGCACCATGTTGGGAGG - Intronic
1025152668 7:56572229-56572251 GGTTACTACAGGCTGGAGGGTGG - Intergenic
1027902958 7:84141662-84141684 GCTTACTGGAGGGTGGAGGGTGG - Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029217172 7:98959059-98959081 CCTCCCTGCACACTGCAGGGAGG - Intronic
1030321033 7:108167673-108167695 GCACACTGCACTTAGGAGGGGGG + Intronic
1031444096 7:121829401-121829423 GATCACTGAAAGCTGGAGAGTGG - Intergenic
1035390155 7:158498217-158498239 GCTCACTCCACCCTGGAAGAAGG + Intronic
1042514108 8:69641873-69641895 CCTCACTGTGCTCTGGAGGGGGG + Intronic
1043921041 8:85983602-85983624 CCTCACTGCACAGTGCAGGGAGG + Intergenic
1049344326 8:142130377-142130399 GCTCCCTGGAAGCTGTAGGGTGG - Intergenic
1049389492 8:142360628-142360650 GCTCCCTTCAGGCTGGTGGGGGG - Intronic
1049637774 8:143698317-143698339 CCTCTCTGCACTCTGAAGGGAGG + Intronic
1052232429 9:26170224-26170246 GCTCACTTCATGGTGGGGGGAGG - Intergenic
1058766984 9:108191249-108191271 ACTCACTGCACGCTGGATTTTGG - Intergenic
1059329165 9:113524253-113524275 GCACACTGCAGGCTGGAGAATGG - Intronic
1060788666 9:126470486-126470508 GCACCCTGGACCCTGGAGGGAGG + Intronic
1061950112 9:133931405-133931427 GCTCCCTGCCTGCAGGAGGGGGG - Intronic
1062371452 9:136241260-136241282 GCTCACTGGACTCGGGAGGATGG - Intronic
1186885590 X:13910112-13910134 GCTACCTCCACCCTGGAGGGTGG + Intronic
1187531198 X:20098544-20098566 GCTCTCTACACGGTGGGGGGGGG + Intronic
1193823613 X:86195677-86195699 GCTCACTGCACTCCAAAGGGTGG - Intronic
1199060511 X:143350652-143350674 ACTCAATGCCAGCTGGAGGGGGG - Intergenic
1200092963 X:153644328-153644350 GCTCGCTGCCCGCCGCAGGGTGG - Intronic
1202275684 Y:23117246-23117268 GCGCACTTCAGGCAGGAGGGTGG + Intergenic
1202290344 Y:23303445-23303467 GCGCACTTCAGGCAGGAGGGTGG - Intergenic
1202428676 Y:24750965-24750987 GCGCACTTCAGGCAGGAGGGTGG + Intergenic
1202442115 Y:24919124-24919146 GCGCACTTCAGGCAGGAGGGTGG - Intergenic