ID: 1158575216

View in Genome Browser
Species Human (GRCh38)
Location 18:58631481-58631503
Sequence CACAAACAGAACATGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158575213_1158575216 5 Left 1158575213 18:58631453-58631475 CCTGGATACCATTGGCACTATTT 0: 1
1: 0
2: 1
3: 8
4: 89
Right 1158575216 18:58631481-58631503 CACAAACAGAACATGATCCAGGG 0: 1
1: 0
2: 3
3: 23
4: 222
1158575214_1158575216 -3 Left 1158575214 18:58631461-58631483 CCATTGGCACTATTTGTAGTCAC 0: 1
1: 0
2: 2
3: 17
4: 102
Right 1158575216 18:58631481-58631503 CACAAACAGAACATGATCCAGGG 0: 1
1: 0
2: 3
3: 23
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158575216 Original CRISPR CACAAACAGAACATGATCCA GGG Intergenic
900804309 1:4757255-4757277 CACAAACAGCACCAGACCCAGGG + Intronic
902291683 1:15439652-15439674 CACACACACACCATGATGCAGGG + Intronic
903380451 1:22893086-22893108 CACAAACAGAACAAACTCAAGGG + Intronic
904406366 1:30291391-30291413 CAAAAACAAAACAAGAGCCATGG + Intergenic
904915643 1:33968419-33968441 CACCAACAGAACATGAAAAAGGG + Intronic
906155018 1:43608979-43609001 CACAAACAGCACAGGAGACAGGG - Intronic
908488196 1:64616176-64616198 GACATACAGAACATGGGCCAAGG - Intronic
908698823 1:66875527-66875549 GACAGTCAGAACTTGATCCAAGG + Intronic
908884204 1:68769049-68769071 CCAAAACACAACATGGTCCAAGG + Intergenic
910161567 1:84277858-84277880 AGCAAACAGAACAGGTTCCATGG + Intergenic
913580139 1:120218507-120218529 CACAAGCAGAACATGAAGGAGGG - Intergenic
916012374 1:160717851-160717873 CACAAACACAGCAAGAGCCATGG - Intergenic
916185927 1:162132835-162132857 CAGAAACAGACCTTTATCCATGG - Intronic
916492988 1:165317900-165317922 CACAAAAGCAACATGATTCAGGG + Intronic
917432078 1:174980695-174980717 CACAAACAAAATAAAATCCAAGG - Intronic
917846544 1:179025496-179025518 CACAAACAGAACTCGACCTAGGG + Intergenic
918496441 1:185142820-185142842 CACACACAGAAAATGATAGAAGG + Intronic
918658372 1:187057323-187057345 AACAAACAGCATATAATCCATGG - Intergenic
918669354 1:187195777-187195799 CAAAAACAGTCAATGATCCAAGG - Intergenic
918943271 1:191027842-191027864 CACAAAAAAAACCTCATCCAAGG + Intergenic
922869218 1:228886760-228886782 CACACACAGAAAAAGAGCCAGGG - Intergenic
924137801 1:240989010-240989032 CACAAACAAAACATGAACATGGG + Intronic
1063359941 10:5444667-5444689 GACAAAAAGAACATGGTCCAAGG - Intronic
1064435322 10:15306046-15306068 CACAAATAGAGCATGATCCATGG + Intronic
1064593861 10:16923136-16923158 CACAATTAGAACATGATATAAGG - Intronic
1064602873 10:17011143-17011165 CACAAGCACTACATGTTCCAGGG + Intronic
1065043895 10:21727619-21727641 AAAGAACAGAACATAATCCATGG + Intronic
1066376081 10:34858656-34858678 GACAAAAAGAAAATCATCCAGGG + Intergenic
1067231526 10:44414904-44414926 CATGTACAGAACATGATCAAGGG - Intergenic
1067568452 10:47354488-47354510 CACACACAGAACTGGAGCCAGGG - Intronic
1067782892 10:49221815-49221837 CACAAACAGCACATGGGGCATGG - Intergenic
1068014609 10:51500392-51500414 CAAATACAAAATATGATCCAGGG - Intronic
1069280629 10:66650166-66650188 CACACACAGAACATTCTTCAGGG + Intronic
1071474063 10:86010012-86010034 CAGACACAGAATAGGATCCAGGG + Intronic
1074005513 10:109419035-109419057 CAACAACAGAGCATTATCCAAGG - Intergenic
1076295773 10:129383191-129383213 CACAAAGAGAAGATGCTCCCAGG + Intergenic
1076518911 10:131067570-131067592 CACAAACTGAACAAGAGTCATGG - Intergenic
1078877175 11:15410453-15410475 CACAACCTGAAAATGATGCATGG - Intergenic
1079725486 11:23875777-23875799 CAGAAAGAGAACCTGATACATGG + Intergenic
1080931985 11:36820378-36820400 CACAACCAGAAGATGATATAGGG + Intergenic
1081306725 11:41521006-41521028 CACAAACTAAACAGGATTCATGG + Intergenic
1081976351 11:47237785-47237807 TAAACACAGAACATGATCAAGGG - Intronic
1082621963 11:55434023-55434045 CAGAAACAGAAGATAATCCTTGG + Intergenic
1082907914 11:58332377-58332399 CACATACAGAACATTCTCCAGGG - Intergenic
1083618978 11:64039669-64039691 CACAAACACAGCCTGCTCCATGG - Intronic
1084310559 11:68313757-68313779 CACAAACAGAACAGGAGCCGCGG - Intronic
1085049931 11:73375249-73375271 CACAACCTGAGCATGACCCAGGG + Intergenic
1085983787 11:81759065-81759087 CACAAACAGAACATGAATACAGG + Intergenic
1086117204 11:83265449-83265471 CACAAGCAGAAAATGATAGAAGG - Intronic
1086236709 11:84640211-84640233 CATGCACAGAACATGATCAAGGG + Intronic
1087250896 11:95898537-95898559 CACAAACAGAACATGATAAATGG + Intronic
1088291570 11:108243635-108243657 CACTTACAGTACATGCTCCATGG - Intronic
1089946202 11:122476680-122476702 CACAAACATATACTGATCCAGGG - Intergenic
1091073828 11:132595227-132595249 CATATTGAGAACATGATCCAGGG + Intronic
1092404285 12:8207069-8207091 CACAAACAGTACATAATTAATGG + Intergenic
1093639005 12:21503357-21503379 CAGAAACAAAACTTGATCCCAGG + Intronic
1098760460 12:74418413-74418435 CAAAAACAGAACAAGAGTCATGG + Intergenic
1098943663 12:76565892-76565914 GACAAAAAGAAAATGATCCCAGG + Intergenic
1099504841 12:83460813-83460835 CACTAAAAGAACATGAACCTAGG + Intergenic
1102297633 12:111749211-111749233 CCCAAAGAGAACATGGTCCTGGG + Exonic
1103192452 12:119013315-119013337 CCAAAACAGAACATGAACCAGGG + Intronic
1105542900 13:21330049-21330071 CAGAAACAGAAATTGAGCCAAGG + Intergenic
1107634257 13:42376597-42376619 TAAAAACAGAAGATGATCCTGGG + Intergenic
1107791886 13:44010824-44010846 CACAAACATCACAAAATCCAAGG + Intergenic
1108114528 13:47112284-47112306 CCCAAAGAGAACAGGATCCATGG - Intergenic
1109178012 13:59179293-59179315 CACACTCAGAACAAGAGCCAAGG + Intergenic
1109314065 13:60728992-60729014 CACAAAAAGAACAATTTCCATGG - Intergenic
1109640656 13:65187072-65187094 CACAAACAGAATCTGCTCCATGG - Intergenic
1110645791 13:77882021-77882043 AACAAGCAGAATATGATCAAAGG + Intergenic
1111099621 13:83566912-83566934 CAGAAACAGACCATTATCTAAGG + Intergenic
1111752310 13:92348639-92348661 CACACAGAGAACATTCTCCAGGG + Intronic
1112295225 13:98180306-98180328 AACAACCAGAACAAGATCCCTGG + Intronic
1113424832 13:110199443-110199465 CACAAGCACAACGTGCTCCAAGG + Intronic
1113537300 13:111077939-111077961 CACAAAGAAAATATGATCAAGGG + Intergenic
1113574622 13:111385805-111385827 GACAAACAGAAAATGATCCAGGG - Intergenic
1113636310 13:111921334-111921356 CACAAAGGAATCATGATCCAGGG + Intergenic
1114907397 14:27147680-27147702 CACACATAGAACATACTCCAAGG - Intergenic
1115261917 14:31463126-31463148 CATGTACAGAACATGATCAAGGG - Intergenic
1115632848 14:35262683-35262705 CATGTACAGAACATGATCAAGGG + Intronic
1117714260 14:58564291-58564313 CACGCACAGAACATGATCAAGGG + Intergenic
1117764627 14:59068532-59068554 CACCAAAAGCACATGTTCCAAGG - Intergenic
1117987596 14:61403698-61403720 CAAAAACAGCTCAAGATCCATGG + Intronic
1124695078 15:31857636-31857658 CATAAACAGCACATGCTCCAGGG + Intronic
1124877017 15:33604567-33604589 GACACACAGAACATGAACGAAGG - Intronic
1125542883 15:40481066-40481088 CACGTACAGAACATGATCAAGGG - Intergenic
1127060089 15:55173617-55173639 CACAAATGGAAAATGATACAAGG - Intergenic
1128279082 15:66379668-66379690 CATGTACAGAACATGATCAAGGG - Intronic
1130262869 15:82372641-82372663 CATGTACAGAACATGATCAAGGG - Intergenic
1131086824 15:89582706-89582728 CACAAACAGTCCAGTATCCAAGG - Exonic
1133440751 16:5819066-5819088 CTCAAACAGAATATGATACCAGG - Intergenic
1133584980 16:7184425-7184447 CACAAACACCTCATGACCCAGGG + Intronic
1135180567 16:20270401-20270423 CACTAACAGAAAATGGTCAATGG + Intergenic
1135618596 16:23933668-23933690 AACAAACAGAAGATGATGGATGG - Intronic
1135618652 16:23933984-23934006 AACAAACAGAAGATGATGGATGG - Intronic
1135841087 16:25876888-25876910 AACAACCAAAACATGATACAAGG - Intronic
1135883535 16:26282532-26282554 TTCAAGCAGTACATGATCCAGGG - Intergenic
1137888267 16:52129876-52129898 CACAAACAAAACATGCTGGAGGG - Intergenic
1141055018 16:80805531-80805553 CCCAAGTAGAAAATGATCCAGGG - Intergenic
1143778007 17:9212202-9212224 CACCAACAGCACCTCATCCAGGG - Intronic
1144459168 17:15443850-15443872 CATGTACAGAACATGATCAAGGG + Intronic
1146505980 17:33405829-33405851 CAGAAACAGAAGATGGTTCAGGG - Intronic
1149268849 17:54955232-54955254 CCCGGACCGAACATGATCCAGGG - Intronic
1151665926 17:75545125-75545147 CACAGACAGAACTTGGTGCAAGG - Intronic
1153245807 18:3072024-3072046 CAAAAAAAGAAAATGATCCAGGG + Intronic
1157866578 18:51192162-51192184 AACAACCTGAAAATGATCCAGGG - Intronic
1158575216 18:58631481-58631503 CACAAACAGAACATGATCCAGGG + Intergenic
1160016799 18:75149258-75149280 TGCACACAGAACATAATCCAAGG - Intergenic
1162231042 19:9266973-9266995 CCCAAAGAAAACATGAGCCAAGG - Intergenic
1164660101 19:29956741-29956763 CATGTACAGAACATGATCAAGGG - Intronic
925967533 2:9079832-9079854 GTCAACCAGACCATGATCCAGGG - Intergenic
929605512 2:43231584-43231606 CACAAACACATCTTTATCCAAGG - Intronic
929847181 2:45542066-45542088 CACAAACAGCCCATGCACCATGG - Intronic
929994115 2:46814471-46814493 CACAAAAAGAAGTTGAACCAAGG + Intergenic
931940365 2:67245350-67245372 AACAATGAGAACATGATTCAGGG + Intergenic
932656945 2:73618519-73618541 CCCAGACTGAACATGATCCAGGG - Intergenic
932663605 2:73678775-73678797 CCCAGACTGAACATGATCCAGGG - Intergenic
933768239 2:85725690-85725712 CAAAAGCAGAACAAGCTCCAGGG + Intergenic
933978925 2:87534793-87534815 CACAGACTGAAAATGACCCATGG - Intergenic
936314904 2:111416005-111416027 CACAGACTGAAAATGACCCATGG + Intergenic
936350974 2:111712317-111712339 CCCAAACTGAACATGATTGAAGG + Intergenic
936893174 2:117395837-117395859 CAGAAACAGAGCATGACCCTTGG + Intergenic
938187841 2:129248777-129248799 AAGAAACAGAACATTATCCAGGG + Intergenic
938753774 2:134361162-134361184 CACAACCAGAACAAGATGAAGGG + Intronic
939255087 2:139733010-139733032 CATATACAGAACATAATCAAGGG - Intergenic
940004158 2:148996358-148996380 CACACAAAGAACATGTTACAAGG - Intronic
940454674 2:153881772-153881794 CACAAACAGAACAGGATATAAGG + Intronic
941018905 2:160387553-160387575 CACAGACAGAAAATGTTCCAGGG - Intronic
943674259 2:190701669-190701691 CACATCCGGAACATTATCCAGGG - Intergenic
943934454 2:193897868-193897890 AACAAACAGAACAGGATGAATGG - Intergenic
947980051 2:234400787-234400809 CACGAACAGAAAACTATCCATGG - Intergenic
947982974 2:234425821-234425843 CACCAGCAGAACATGACTCAGGG - Intergenic
1170532278 20:17306421-17306443 CTCAAACAGAAGATGGTCCCAGG + Intronic
1170758663 20:19229717-19229739 TACAAACAGTTCATGTTCCAAGG - Intronic
1172177503 20:32981131-32981153 CACAAACACTACATAATCCACGG - Intergenic
1172535940 20:35673294-35673316 AAAAAAAAGAACATGATCTACGG + Intronic
1175391394 20:58629702-58629724 CCCAAACAGAACACAATTCAGGG + Intergenic
1175498650 20:59433588-59433610 CAGAAACAGACCATGAGACAAGG + Intergenic
1175858320 20:62134695-62134717 CACTTATACAACATGATCCATGG - Exonic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178166061 21:29979040-29979062 CACAAAAAGAACTTGTTCCAAGG + Intergenic
1178483533 21:33002239-33002261 CAGAAACAGAAGATGAGCCCAGG + Intergenic
1181041993 22:20196646-20196668 CACACACAGAGCCTGAGCCAAGG - Intergenic
1181811043 22:25404269-25404291 CACAAACAGAACAGGAGCCCAGG + Intronic
950042780 3:9930864-9930886 TACAAACAGAACCAAATCCAGGG - Intronic
951043672 3:18015271-18015293 CACATATAGCACATCATCCATGG + Intronic
952722242 3:36545433-36545455 CAGAAACAGAACCTGACACAGGG - Intronic
954412527 3:50377174-50377196 CACAAACAAAACATAAACAATGG - Intronic
954960792 3:54563115-54563137 CACACACAGGACATGATCACAGG + Intronic
956099872 3:65756833-65756855 CACAAACACACCATCATACAAGG + Intronic
957129241 3:76201978-76202000 CCAAACAAGAACATGATCCAAGG + Intronic
960711446 3:120534166-120534188 CAAATCAAGAACATGATCCAAGG + Intergenic
960969205 3:123127168-123127190 CACAATCAGAACCTCATCTAAGG - Intronic
961036231 3:123643872-123643894 CACAAACATGAGATGAGCCATGG + Intronic
962694477 3:137934029-137934051 CAAAAACAGCACATGCTCTATGG - Intergenic
962942475 3:140138323-140138345 CAGACACAGAAAAAGATCCATGG - Intronic
963349360 3:144133991-144134013 TAGAAACAGAAAATGTTCCAAGG + Intergenic
963730558 3:148967074-148967096 AACAAACAAAACTTGTTCCAGGG + Intergenic
963995009 3:151698403-151698425 CACAAATAAAACATGATTAAAGG + Intergenic
969266839 4:6070142-6070164 CACAAAGAGGACATATTCCATGG + Intronic
969761769 4:9190627-9190649 CACAAACAGTACATAATTAATGG - Intergenic
970680936 4:18507149-18507171 CAGAATCAGAAAATGCTCCAAGG - Intergenic
971466349 4:26966954-26966976 GAGAAACAGAAGATTATCCAAGG - Intronic
972247527 4:37260878-37260900 CACATACAACACATGATACAGGG + Intronic
972476724 4:39457596-39457618 CATGTACAGAACATGATCAAGGG - Exonic
972972219 4:44591708-44591730 TACAAATGGAACTTGATCCAAGG - Intergenic
973693027 4:53459537-53459559 AACAAACAGAACAAGATTTAAGG - Exonic
974505619 4:62767328-62767350 CATAAAAAGAACATGGTACAAGG + Intergenic
974613179 4:64243209-64243231 GAAAAACATAATATGATCCACGG - Intergenic
974858013 4:67483729-67483751 CACAAACAGCACATCAGCCTTGG - Intronic
975176723 4:71297982-71298004 CAGAAGCAGAACTTGAACCAAGG - Intronic
977195736 4:94056545-94056567 CTGAAATAAAACATGATCCAAGG - Intergenic
982505148 4:156207627-156207649 CACAAACATAGCACAATCCATGG + Intergenic
982624676 4:157751550-157751572 CACCAACAGAAAATTATCAAGGG + Intergenic
982707807 4:158729217-158729239 CAGAAAGAGAACAAGATTCATGG + Intergenic
983434652 4:167697525-167697547 CAGAAACAGGACATTGTCCAAGG + Intergenic
983895262 4:173074630-173074652 CAGAAACAGAACAAGATGCATGG + Intergenic
984865901 4:184280487-184280509 CAAAAACAGAATTTAATCCATGG - Intergenic
989506250 5:42230289-42230311 CACAAATATAAAAGGATCCATGG - Intergenic
990135428 5:52638818-52638840 CACTATCAGTACAGGATCCAGGG - Intergenic
990758438 5:59101989-59102011 CACACATACAACATAATCCAGGG + Intronic
992137660 5:73763564-73763586 CCCAAACAGAACAGGGTCCCTGG + Intronic
992796412 5:80257934-80257956 CAAAAAGAGGACATGATTCAGGG - Intergenic
993680960 5:90877244-90877266 ACTAAACAGAACATAATCCAAGG - Intronic
993998703 5:94752716-94752738 CACAAACACAAAAACATCCAAGG + Intronic
995545196 5:113223245-113223267 CACAAACAGAACATGCTTATGGG - Intronic
995681471 5:114725647-114725669 TACTAACAGAACATAATACATGG + Intergenic
995910353 5:117179543-117179565 CAGAAACAGACCTTGATGCAGGG + Intergenic
996634503 5:125673783-125673805 CAGAGACAGAACCTGAGCCAAGG - Intergenic
998685726 5:144522349-144522371 AGCATACAGAACATGATCAAAGG + Intergenic
1000413098 5:160954762-160954784 AAACAAAAGAACATGATCCATGG - Intergenic
1009435735 6:63616158-63616180 CATGTACAGAACATGATCAAGGG - Intergenic
1010060362 6:71615616-71615638 AACAAACAGGAGATGATCAAAGG - Intergenic
1014646586 6:123981402-123981424 GAAAAACAGAACATTTTCCAGGG + Intronic
1014897277 6:126917668-126917690 GACAAATAGAACAAGCTCCAAGG - Intergenic
1016772235 6:147864213-147864235 CACAAACAGAACATTTTCTAGGG - Intergenic
1017907467 6:158766993-158767015 CACAACGAGAACATGAGGCAAGG - Exonic
1022226610 7:28369904-28369926 CAGAAGCAGAACATGAGCCAGGG - Intronic
1022553363 7:31264083-31264105 CACAAACAAAACTTAATTCAAGG - Intergenic
1022554391 7:31277772-31277794 CACAAAGTGAGCATGATACAAGG + Intergenic
1028382981 7:90219653-90219675 CACACACACATCATGATCAAAGG - Intronic
1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG + Intronic
1030742245 7:113123903-113123925 CACAGACAGTAGAGGATCCAGGG + Intergenic
1030975167 7:116113077-116113099 CACATTCAGAATATGAACCAAGG - Intronic
1032000410 7:128261546-128261568 CACACACAGAACTGGCTCCAGGG + Intergenic
1033566287 7:142581240-142581262 TACAGACAGACCATGATGCAAGG + Intergenic
1036289683 8:7476435-7476457 CACAAAAAGAAAATTAGCCAGGG + Intergenic
1036331795 8:7835097-7835119 CACAAAAAGAAAATTAGCCAGGG - Intergenic
1036805402 8:11828545-11828567 CCCAGACAGAACATCAGCCACGG + Intronic
1036844761 8:12158394-12158416 CACAAACAGTACATAATTAATGG + Intergenic
1036866131 8:12400726-12400748 CACAAACAGTACATAATTAATGG + Intergenic
1038946364 8:32365223-32365245 ATCAAATAGAACATGAACCAAGG - Intronic
1039116401 8:34095893-34095915 CAAAAGCAGAACATGATGCAGGG - Intergenic
1040085330 8:43334195-43334217 CAAAAACAGACCATGATGAATGG - Intergenic
1041936274 8:63335356-63335378 GTCAAACAGAACGTGACCCATGG - Intergenic
1043267213 8:78281232-78281254 CAGAAGCAGAACTTGAGCCAAGG - Intergenic
1043454487 8:80399936-80399958 CACTAACAGGACATGACCCGAGG + Intergenic
1044053786 8:87542777-87542799 CACCAACAACATATGATCCATGG + Intronic
1046190901 8:110792706-110792728 CACAAACAGAAGATATTGCATGG + Intergenic
1046876772 8:119263627-119263649 AAAAAACAGAACATTTTCCATGG + Intergenic
1048532044 8:135258662-135258684 CACACACAGAAAATGAGCAAAGG + Intergenic
1048630499 8:136237383-136237405 ACCAAACACAACATGATCAAAGG - Intergenic
1048681179 8:136843224-136843246 CACAACCAGCACTTGAACCATGG + Intergenic
1049943805 9:575048-575070 CAAAAACAGAAAAAGATCCTGGG + Intronic
1050995683 9:12214545-12214567 CACAAAGAGAACATATTTCATGG + Intergenic
1051850823 9:21505755-21505777 CACAAAGAGAATATGATGGATGG + Intergenic
1052994841 9:34546474-34546496 CAGAAACACAGCATGAACCAAGG + Intergenic
1053278676 9:36802249-36802271 CACAATCAGAGCTTGTTCCATGG - Intergenic
1053567741 9:39270801-39270823 CACAAAAAGTACATAATCCTTGG - Intronic
1053833752 9:42111748-42111770 CACAAAAAGTACATAATCCTTGG - Intronic
1054129402 9:61348198-61348220 CACAAAAAGTACATAATCCTTGG + Intergenic
1055696336 9:78889143-78889165 CACAGGCAGAACATGAGCAAAGG + Intergenic
1056716522 9:89035537-89035559 CAGAAACAGACCATGATGCAAGG + Intronic
1058278280 9:103075404-103075426 CACACACAGAACATTCTACAGGG + Intergenic
1058677107 9:107409675-107409697 CACAAACAGAATGTGATTCTGGG - Intergenic
1061641703 9:131963125-131963147 CCCAAACAGAAAATGATGTATGG - Intronic
1186364126 X:8873870-8873892 CAAAATCACAACATGATGCATGG + Intergenic
1187275578 X:17814029-17814051 CACAAACAGACCCTGAGGCAAGG + Intronic
1187879898 X:23837073-23837095 CATGTACAGAACATGATCAAGGG - Intronic
1188206559 X:27366489-27366511 CACAAAAAGAAAAAAATCCAAGG + Intergenic
1190264182 X:48817670-48817692 CACTTACAAAACAGGATCCAGGG + Intronic
1190463910 X:50706961-50706983 CACAAACAGACCATGAACAGTGG + Intronic
1190822793 X:53989813-53989835 CTCATACAGAGCTTGATCCATGG + Intronic
1191749431 X:64525767-64525789 AACAAACAGAGCATGGTACAGGG + Intergenic
1192551432 X:72057402-72057424 AAGAAACAGAATATGATCTATGG - Intergenic
1195019178 X:100809505-100809527 CAGAAACAGAAGATCATTCAAGG - Intergenic
1197160997 X:123321845-123321867 CACAAAGAGAAAATGAGCTATGG + Intronic
1197360374 X:125494434-125494456 CACAAACAGATCTTGAAACAAGG - Intergenic
1198716164 X:139559669-139559691 GACAAAAAGAACATGCCCCAAGG + Intronic
1200372411 X:155740787-155740809 CACAAAGATCACATGATTCAAGG - Intergenic