ID: 1158578064

View in Genome Browser
Species Human (GRCh38)
Location 18:58657126-58657148
Sequence CCACAGGAACAATTTGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158578060_1158578064 24 Left 1158578060 18:58657079-58657101 CCAGTTAAAGCATCTTCAGAAAG No data
Right 1158578064 18:58657126-58657148 CCACAGGAACAATTTGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158578064 Original CRISPR CCACAGGAACAATTTGGCTT AGG Intergenic
No off target data available for this crispr