ID: 1158579667

View in Genome Browser
Species Human (GRCh38)
Location 18:58671049-58671071
Sequence AGTCAGGGGAGAGCGCTCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158579657_1158579667 23 Left 1158579657 18:58671003-58671025 CCCACTGCAGGATGCTGGTGTGT No data
Right 1158579667 18:58671049-58671071 AGTCAGGGGAGAGCGCTCGCCGG No data
1158579658_1158579667 22 Left 1158579658 18:58671004-58671026 CCACTGCAGGATGCTGGTGTGTC No data
Right 1158579667 18:58671049-58671071 AGTCAGGGGAGAGCGCTCGCCGG No data
1158579661_1158579667 -2 Left 1158579661 18:58671028-58671050 CCGGGCACATGAAAGTCCCTGAG No data
Right 1158579667 18:58671049-58671071 AGTCAGGGGAGAGCGCTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158579667 Original CRISPR AGTCAGGGGAGAGCGCTCGC CGG Intergenic
No off target data available for this crispr