ID: 1158580908

View in Genome Browser
Species Human (GRCh38)
Location 18:58681951-58681973
Sequence TGGTCTACAGCAGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158580900_1158580908 22 Left 1158580900 18:58681906-58681928 CCCTCTTCTCCATTCAGCTGCTC 0: 1
1: 0
2: 3
3: 41
4: 480
Right 1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG 0: 1
1: 0
2: 2
3: 65
4: 267
1158580903_1158580908 -2 Left 1158580903 18:58681930-58681952 CCTCTCAGCTGCAGATAGAGTTG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG 0: 1
1: 0
2: 2
3: 65
4: 267
1158580901_1158580908 21 Left 1158580901 18:58681907-58681929 CCTCTTCTCCATTCAGCTGCTCT 0: 1
1: 0
2: 3
3: 53
4: 467
Right 1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG 0: 1
1: 0
2: 2
3: 65
4: 267
1158580902_1158580908 13 Left 1158580902 18:58681915-58681937 CCATTCAGCTGCTCTCCTCTCAG 0: 1
1: 0
2: 2
3: 37
4: 348
Right 1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG 0: 1
1: 0
2: 2
3: 65
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158580908 Original CRISPR TGGTCTACAGCAGTGGTGGA GGG Intronic
900289005 1:1915939-1915961 TGGGCAGCAGCAGTGGTGGCAGG + Intronic
900556092 1:3281312-3281334 TGGTCTGGAGCACAGGTGGAGGG - Intronic
900743265 1:4343432-4343454 GGGGCTACTGCAGTGGGGGAGGG - Intergenic
900743289 1:4343506-4343528 GGGGCTACTGCAGTGGGGGAGGG - Intergenic
901152618 1:7113997-7114019 TGGGTTACAGCAGTGGTGGGAGG - Intronic
904843345 1:33388767-33388789 TGATCTAAAGCAATGCTGGAAGG - Intronic
906315009 1:44781078-44781100 GGGACTACAGCTGTGGTGCAGGG + Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602971 1:55788566-55788588 CGGTGAACAGCCGTGGTGGACGG + Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910173357 1:84401512-84401534 TGGGCTTCAGGAGAGGTGGAAGG - Intronic
913298245 1:117343229-117343251 GGGACTAGGGCAGTGGTGGAGGG + Intergenic
913351379 1:117864283-117864305 AGTTCTACATTAGTGGTGGAAGG + Exonic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918058181 1:181040635-181040657 TGGGCTGAACCAGTGGTGGATGG + Intronic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920103766 1:203535689-203535711 TGGTCTGCAGCAGTGTTTGCAGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924740283 1:246790880-246790902 AGGTCTACAGCTGCGGAGGATGG + Intergenic
1065168421 10:23004795-23004817 TGGAGTACGGCAGTGGTGGCAGG - Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067577961 10:47419747-47419769 TGGTCTGGAGCAGGGCTGGATGG - Intergenic
1067577980 10:47419813-47419835 TGGTCTGGAGCAGGGCTGGATGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069518740 10:69100931-69100953 TGGGCTACAGCGATAGTGGAAGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1073420086 10:103417705-103417727 TCCTCTGCAGCAGTAGTGGAGGG + Intronic
1074264462 10:111887765-111887787 TAGTCTAGAGCAATGGGGGAAGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076803697 10:132844727-132844749 TGGTCTGCAGCCGTGCGGGAGGG + Intronic
1079621974 11:22566655-22566677 TACCCTACAGTAGTGGTGGAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081483247 11:43507932-43507954 TGGCCTACAGCAGTGGTTCTGGG - Intergenic
1082959245 11:58903195-58903217 TGGTGTACAGCAGTGCTGCTTGG + Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086063551 11:82724053-82724075 TGGTATCCAGCAGTGGAGGGAGG - Intergenic
1086577778 11:88360531-88360553 TGGTCTTCAGTAGAGGTTGAAGG - Intergenic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088278112 11:108110528-108110550 TTTTCTTCAGCAGTGGTTGATGG + Intergenic
1088425093 11:109693628-109693650 TGGGCACCAGCAGTGGTGGGTGG - Intergenic
1092293641 12:7181266-7181288 TGGTGATCAGCAATGGTGGACGG - Intergenic
1092470438 12:8773629-8773651 TTGTCAACAGCAGTGCTGGCTGG - Exonic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093511632 12:19936122-19936144 TGGTCTAAAGCACTGGAGCATGG - Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1098190064 12:67938511-67938533 TGGTGGACATCAATGGTGGAAGG + Intergenic
1103040806 12:117693960-117693982 TGGTCTACAACACTGATTGAAGG + Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104808909 12:131608207-131608229 CGGATTCCAGCAGTGGTGGAGGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1107299794 13:38953686-38953708 TGATGAAAAGCAGTGGTGGAGGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1113639551 13:111947411-111947433 AGGTCTACTGCAGGGGTGGGTGG - Intergenic
1114347400 14:21810530-21810552 TGGTCAATAGTATTGGTGGATGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117912776 14:60650115-60650137 TGGTGTGCAGCAGTGGGGGGAGG - Intronic
1118046792 14:61978767-61978789 TGGACTAAAGCAGTGAGGGAGGG - Intergenic
1118815813 14:69313186-69313208 TGGGCTACAGCAGCTGTGGCTGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120408795 14:84124003-84124025 TGGGCTACGGCAGTGGGAGAAGG - Intergenic
1120845329 14:89120059-89120081 TGGTGCTCAGTAGTGGTGGAGGG + Intergenic
1121472386 14:94165628-94165650 TGGGCTCCAGCAGTTGAGGAGGG - Intronic
1122540690 14:102496245-102496267 TGGTCACCAGCAGTGCTGGTGGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127391022 15:58505205-58505227 TGGGCTACAGCAGGGCTGGCAGG + Intronic
1127692726 15:61413872-61413894 TGCTCACCAGCAGTGTTGGATGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129661604 15:77555945-77555967 AGGTCTCCATCAGTGCTGGAGGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG + Intergenic
1131557593 15:93413284-93413306 TGTTTTACAGGAGTGGTAGAAGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132161416 15:99546701-99546723 TGGTCTACAGCATTTATGGGTGG + Intergenic
1133231228 16:4367598-4367620 TGGGCCTCAGCAGTGGGGGAAGG + Intronic
1133915177 16:10102861-10102883 TGATCTAGAACAGTGGAGGAAGG - Intronic
1135538580 16:23312882-23312904 TGGTGAAGAGCTGTGGTGGAGGG + Intronic
1139559722 16:67734412-67734434 TCGTCTATAGCGGTGGTGGAGGG - Intronic
1140336250 16:74107648-74107670 TGGTCTATATGAGTGGTAGATGG - Intergenic
1144442930 17:15300297-15300319 TGCTTTGCAGCAGTGCTGGAAGG - Intergenic
1144484608 17:15654330-15654352 GGGTCTTCAGCAGTGGAAGAGGG - Intronic
1144642902 17:16948383-16948405 GAGTCTGCAGCACTGGTGGAGGG + Intronic
1145052886 17:19677822-19677844 TGGTATACAGGACTGGTGGCAGG - Intergenic
1147535032 17:41315302-41315324 GGGACTGCATCAGTGGTGGAGGG + Exonic
1148793046 17:50184300-50184322 TGGGCTGCAGCTGTGGAGGAGGG + Exonic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150209458 17:63434206-63434228 TGGTCTATAGCAGCGGAGAAAGG + Exonic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152887371 17:82860335-82860357 TGGCCTTTCGCAGTGGTGGAGGG + Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154076187 18:11204081-11204103 TGGTCCACAGCTGTGGTGACTGG + Intergenic
1155716153 18:28946123-28946145 TGGTCAACAGCAGTGGGGTTTGG + Intergenic
1155922439 18:31616765-31616787 TTGTCCACAGCAGTGCTGGTTGG - Intergenic
1157139533 18:45091885-45091907 TGGCCTAGAGAAGTGGAGGAGGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1161429678 19:4224348-4224370 TGGTCTATGGGAGTGGTGGAGGG + Intronic
1162007761 19:7790724-7790746 TGGTTCTCAGCAGTGGTGGATGG - Intergenic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1167099987 19:47398902-47398924 TGGTCGAGGGCAGTGGTTGAGGG - Intergenic
1167268039 19:48493217-48493239 GGGTCTACAGCAGGGTTTGAAGG - Intronic
1167766694 19:51487985-51488007 TGGTTTACAGCAGTGCTGTCCGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168386502 19:55967701-55967723 GGGTATATACCAGTGGTGGATGG + Intronic
925684628 2:6458580-6458602 TGGTGAAGAGCAGGGGTGGAGGG + Intergenic
927186673 2:20487139-20487161 TGGTCTGCAGCCATGGAGGAGGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG + Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928731486 2:34237692-34237714 TCTGCTACAGCAGTGGGGGAAGG + Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933252548 2:80045093-80045115 TGGACTTCAGAAATGGTGGATGG + Intronic
933555534 2:83825980-83826002 TGAACTAAAGCAGTGGTGGTAGG + Intergenic
937541913 2:122966140-122966162 TGGCCTGAAGCAGTGGGGGAAGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943119975 2:183723710-183723732 GGGTCCACAGGAGTGGTGGATGG + Intergenic
944840011 2:203615742-203615764 GGGTCAACAGCACAGGTGGAGGG + Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
948725854 2:239933453-239933475 CAGCCTACAGCAGTGGTGGCAGG - Intronic
1169012120 20:2259524-2259546 TGGGCTTCTGCAGTGGTGAATGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173218969 20:41115723-41115745 GGGTCTCCAGCAGGGGTGGCTGG - Intronic
1173542665 20:43866441-43866463 TGGTCTTGACCTGTGGTGGATGG + Intergenic
1173742059 20:45407999-45408021 TGGGCTGCAGCACTGGAGGAAGG + Exonic
1174940358 20:54919896-54919918 TGGTCACCAGCAGAGGTAGATGG + Intergenic
1175706694 20:61184084-61184106 GGGTCTACATCAGGGGAGGAGGG - Intergenic
1176204026 20:63878534-63878556 TGGGCTGCAGCAGTGGGGGCAGG - Intronic
1177183415 21:17767597-17767619 GTGTCTCCAGAAGTGGTGGATGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177757057 21:25360732-25360754 TGGGCTGCAGCAGTGATGAAGGG - Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178830364 21:36051222-36051244 TTGTCAACAGCAGTGCTGGCTGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179569718 21:42271290-42271312 TGGTCTACAGCAGTAGTCCAGGG + Intronic
1179913243 21:44461077-44461099 TGGGGTCCAGCAGTGGGGGATGG + Exonic
1182454883 22:30443959-30443981 TGGGGTACAGCAGTGGTAGGTGG - Intergenic
1184195437 22:42924600-42924622 GGGTGGACAGCAGTGGTGGCGGG - Intronic
949768274 3:7550760-7550782 TGGTCTATAGCTGTGGTGTGTGG + Intronic
949782794 3:7709037-7709059 TTGACTACAGAGGTGGTGGAAGG - Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951611729 3:24497207-24497229 TGTTCTACAACAATGGGGGAGGG + Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955795648 3:62633727-62633749 TGCTTCACAGCAGTGGTGCAGGG + Intronic
957895103 3:86411956-86411978 TGGCGTTCAGCAGGGGTGGACGG - Intergenic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961905772 3:130261469-130261491 TGGGATACAGCAATGGAGGATGG - Intergenic
962806973 3:138934723-138934745 TGGTCTCCAGCAGAGGGAGATGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963068306 3:141281363-141281385 TGGGCTGGAGCAGTGATGGAGGG + Intronic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963587696 3:147214091-147214113 TAGTCCACAGCAATGGTGGCAGG + Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
966931895 3:184680830-184680852 TGGGCTGCAGGAGTGGTGGGGGG + Intronic
967904357 3:194487904-194487926 TGCTCTCCAGGTGTGGTGGACGG - Intronic
968288378 3:197521277-197521299 TAGAATACAGCAGTGGGGGATGG - Intronic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969989344 4:11245352-11245374 TGTTATACAGTAGTGGTTGAGGG - Intergenic
970580587 4:17470988-17471010 TGGGCTAAAGCAATGGAGGAAGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974804639 4:66861981-66862003 TGGTGTACATTAGTGATGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977654549 4:99505690-99505712 CAGTCTCCAGCAGGGGTGGAGGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985385517 4:189443236-189443258 TGGTTTAAAGCACTGATGGATGG - Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990129785 5:52566727-52566749 TGATCTTCAGGAGTGGTGGAAGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994851968 5:105067286-105067308 AGGTGTCCAACAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
997368139 5:133338889-133338911 TGAACTACAGCAGAGGTGGTAGG - Intronic
997780010 5:136647449-136647471 TAGTCAAGAGCATTGGTGGAAGG - Intergenic
998774671 5:145585930-145585952 TGATCTACAGCAGTGATTCATGG - Intronic
1000514002 5:162217962-162217984 TGGTATACAGTAGTTGTGGTAGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009229363 6:61043668-61043690 TGGTGAACAGCAGTGGGGGTGGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1013764464 6:113558542-113558564 TGGTCTACAGCACTGGATGGGGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015297576 6:131615338-131615360 AGGTCTAGAGCATTGGAGGATGG + Intronic
1015634605 6:135263315-135263337 TGGTATACAAATGTGGTGGAAGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1019872125 7:3774283-3774305 AGGCCTACAACAGTGGGGGAAGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023088842 7:36599429-36599451 TTGTCCACAGCAGTGCAGGATGG - Intronic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1026440244 7:70437884-70437906 CAGTCTTCAGCAGTGGTAGAAGG + Intronic
1026477468 7:70749290-70749312 TGTTCTACAGCACTGCTGGGAGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028353924 7:89883365-89883387 TGGACTACAGTAGTGGTAGTTGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029476705 7:100789315-100789337 TGGTCGTCAGCTTTGGTGGAAGG + Exonic
1029733973 7:102455424-102455446 TGCTCTGCAGGAGTGCTGGAAGG + Exonic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032143300 7:129354196-129354218 TGATCCAGAGCACTGGTGGAAGG + Intronic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032901957 7:136320483-136320505 TGGGATACAGCAGTAGTGGTGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035920201 8:3668223-3668245 TGAGATCCAGCAGTGGTGGACGG - Intronic
1036121215 8:6019957-6019979 TGGCCTCCAGCAGTGGAGGTGGG + Intergenic
1036908038 8:12724320-12724342 CAGTCTACAGCAGTGGAGAAAGG - Intronic
1037435425 8:18857634-18857656 TGGTCTACAACGGTGGTCCATGG - Intronic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1037990228 8:23316573-23316595 TGCTCTACAGAGGAGGTGGAGGG + Intronic
1039360011 8:36866006-36866028 TGGTTTTCAGAAGTGGTGGGTGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040891933 8:52326254-52326276 TGGCCTGCAGCAGTGGGGAAGGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1044487053 8:92766392-92766414 TGGACAACAGCAGAGGTGGCTGG + Intergenic
1044742655 8:95343567-95343589 TGTGCTACATGAGTGGTGGAGGG + Intergenic
1044764741 8:95559519-95559541 TGGACCAAAGCAGTGGTGGTGGG + Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046833741 8:118776739-118776761 TGGTCTACTGGAGTGAAGGAAGG - Intergenic
1047745650 8:127843006-127843028 TGGTCTACAGAAGTGACAGATGG + Intergenic
1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1052826147 9:33176693-33176715 GGGACTCCAGCAGAGGTGGAGGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053169817 9:35870422-35870444 TGGTCCACAGCTGGGATGGAAGG + Exonic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1057807883 9:98233613-98233635 TGAGCTCCAGCAGTGGTGGCGGG - Intronic
1058328558 9:103728585-103728607 TGAACTAAAGCAGTGGTGGTGGG - Intergenic
1059287723 9:113190488-113190510 TGGAATCCAGCTGTGGTGGAAGG + Exonic
1060220247 9:121760704-121760726 TCCTCTGCAGCAGTGGTGGAAGG - Intronic
1061421697 9:130476274-130476296 TCGTCTGATGCAGTGGTGGAGGG - Intronic
1062283008 9:135760267-135760289 TGGGCCACAGCAGTGGTGACGGG - Intronic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1186397624 X:9225666-9225688 TGGTTAACAGCAGTTATGGAGGG - Intergenic
1187242696 X:17528079-17528101 TTGTCTAGGGCAGTGGGGGAGGG + Intronic
1187770540 X:22690946-22690968 AGGTCAAGAGCAGTGGAGGATGG - Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194006465 X:88499647-88499669 TGGTCTTCAGCAGTGTTGTTAGG - Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195256572 X:103096771-103096793 TGCAATACAGCAGTGGTGAATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196202604 X:112902423-112902445 TGGTCTGAAGCAGTTCTGGAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199303576 X:146240992-146241014 TGGTGTCCATCAGTGGAGGATGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200126917 X:153819537-153819559 TACTCTACAGCAGTGGGGTAAGG - Intronic
1200164749 X:154028445-154028467 TGGTCCATAGCTGTGGTGTAGGG - Intronic
1200849217 Y:7865528-7865550 TGGTGACCAGCACTGGTGGATGG + Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic