ID: 1158582223

View in Genome Browser
Species Human (GRCh38)
Location 18:58693686-58693708
Sequence CTGAGTAACCAGATGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 6, 3: 28, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158582219_1158582223 15 Left 1158582219 18:58693648-58693670 CCTTAAGAATGATGCTAAGAAAC 0: 1
1: 0
2: 0
3: 18
4: 235
Right 1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG 0: 1
1: 0
2: 6
3: 28
4: 196
1158582218_1158582223 16 Left 1158582218 18:58693647-58693669 CCCTTAAGAATGATGCTAAGAAA 0: 1
1: 0
2: 6
3: 46
4: 541
Right 1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG 0: 1
1: 0
2: 6
3: 28
4: 196
1158582217_1158582223 23 Left 1158582217 18:58693640-58693662 CCTAGGGCCCTTAAGAATGATGC 0: 32
1: 249
2: 426
3: 533
4: 512
Right 1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG 0: 1
1: 0
2: 6
3: 28
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158582223 Original CRISPR CTGAGTAACCAGATGGATGG TGG Intronic
900535872 1:3177032-3177054 ATGAGTTAACAGATGGATGAGGG - Intronic
900900396 1:5512064-5512086 CTGAGAAGCCTCATGGATGGTGG + Intergenic
901094831 1:6669793-6669815 CAAAGTTATCAGATGGATGGGGG + Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
902884868 1:19397536-19397558 AAGAGTCACCAGCTGGATGGTGG + Intronic
904817759 1:33218764-33218786 CTGAGAAACCAGATGGGTTAAGG - Intergenic
905873149 1:41416326-41416348 CTGAGGAACCTGCTGGGTGGGGG + Intergenic
907564209 1:55419493-55419515 CTGAGTAACCTGCTTGCTGGTGG + Intergenic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
910048946 1:82954663-82954685 CTGAGTGACCTGTTGGATGTGGG - Intergenic
911613154 1:99979244-99979266 CAGAGCAACCAGATGGAGTGAGG - Intronic
912744865 1:112237747-112237769 CTGAGTAATCAGAGGGTAGGAGG - Intergenic
915900373 1:159842469-159842491 ATGAGTAACCAGGCAGATGGAGG + Intronic
917536522 1:175878223-175878245 ATGAGGATCGAGATGGATGGAGG - Intergenic
918763291 1:188444006-188444028 CTGAGTAACTCGATGTATGGTGG + Intergenic
919706682 1:200682963-200682985 TTGAGAATCCAGAAGGATGGGGG + Intergenic
920953864 1:210599511-210599533 TTGAGTAGCTAGATAGATGGTGG - Intronic
922785971 1:228282381-228282403 CTGAGTCACCTGCTGGATGCTGG + Intronic
923854333 1:237829471-237829493 ATTAGCCACCAGATGGATGGTGG + Intronic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG + Intronic
1070027196 10:72643062-72643084 CTTACTAACCAGAGCGATGGTGG + Intergenic
1070153942 10:73821918-73821940 CTGAGTAACTGGGTAGATGGTGG - Intronic
1071440560 10:85688693-85688715 ATGAGTGGCCAGGTGGATGGTGG + Intronic
1071515284 10:86292916-86292938 CTGTGTGAAGAGATGGATGGGGG + Intronic
1072825429 10:98601390-98601412 CTGATTAATCTGATGGATGGAGG - Intronic
1073213337 10:101822214-101822236 CTGAGCAACTAGATGGATGTTGG + Intergenic
1078110047 11:8385035-8385057 TTCAGTAACCAGATTGATGGTGG - Intergenic
1078798132 11:14614612-14614634 TTGAGAAACTAGATCGATGGTGG - Intronic
1078846483 11:15123448-15123470 CTGAGTAACCAGATAGATGATGG + Intronic
1081615372 11:44587655-44587677 CTGAGCCACCAGGTGGGTGGAGG + Intronic
1085129089 11:74022298-74022320 AGGAGTAACTACATGGATGGTGG + Intronic
1085931232 11:81086082-81086104 CTGAGGAAGCACCTGGATGGCGG - Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1091789777 12:3265133-3265155 CTGAGTAACTAACTGGCTGGAGG + Intronic
1092355665 12:7792965-7792987 CTGAATAAGCAGATCCATGGAGG - Exonic
1092410451 12:8248924-8248946 CTGACCAACCAGATGGTTTGAGG - Intergenic
1092827339 12:12413494-12413516 CTGAGAAATCAGATGGTTGCCGG - Intronic
1095827586 12:46546346-46546368 TTGAGTAACTAGATATATGGTGG + Intergenic
1095837460 12:46654277-46654299 ATAAGTAGCCAGGTGGATGGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG + Intergenic
1097611334 12:61825048-61825070 CTCAATAACCAGATACATGGAGG + Intronic
1099859366 12:88208491-88208513 CTTAGTCACAAGATGGATGTGGG + Intergenic
1099971904 12:89509174-89509196 ATGAGTAAACAGATAAATGGAGG - Intronic
1100957404 12:99924172-99924194 ATAAGCAACAAGATGGATGGTGG + Intronic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1107676379 13:42802119-42802141 TTGAGTAACCAAGTGCATGGTGG - Intergenic
1109864601 13:68246339-68246361 CTAAGTAACCAGATTGTTGCTGG - Intergenic
1110614000 13:77521165-77521187 CTGAAAAACAAGATGGATGCTGG - Intergenic
1111261154 13:85742192-85742214 CTAAGTAACTAGGTGAATGGTGG + Intergenic
1112938176 13:104826799-104826821 CTGAACAACCTGATGGATGCTGG - Intergenic
1112950552 13:104990621-104990643 CTGTGTAACCTGATGAATTGTGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1115576699 14:34718226-34718248 CTGAGAAACAATGTGGATGGAGG + Intergenic
1121579333 14:95015188-95015210 CTGAGTCACCACATGGAGAGCGG - Intergenic
1122482436 14:102055692-102055714 CTGAGCAACCAGATACCTGGAGG - Intergenic
1124413008 15:29452198-29452220 CTGAGAAAGCAGATGGTTGTGGG - Intronic
1124661790 15:31555732-31555754 CGGAGGAGTCAGATGGATGGTGG + Intronic
1125032300 15:35084922-35084944 CTGAATAAGCAGATCCATGGAGG + Intergenic
1125452420 15:39823383-39823405 ATGAGCAACCAGGGGGATGGAGG - Intronic
1129803634 15:78436691-78436713 TTGGGCAACCAGGTGGATGGTGG + Intergenic
1131163077 15:90121838-90121860 TTGAGTAACCTGAGAGATGGAGG - Intergenic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1132118957 15:99159958-99159980 CTGAGGAACTAGATGGAGTGGGG + Intronic
1133413859 16:5590641-5590663 CTGAGGAACCATATGGGTGGAGG + Intergenic
1134539430 16:15053142-15053164 CTAAGTAACCAGATGGCTCGTGG + Intronic
1136470844 16:30478960-30478982 CTTGGTAACCAGTTGGATAGAGG + Intronic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1139495315 16:67312680-67312702 CTGAGCAACCAGATGAATGGTGG - Intronic
1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG + Intronic
1141055491 16:80810037-80810059 CTGAGTATTCAGGTGAATGGAGG + Intergenic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1142478624 17:204589-204611 GTGAGTGAGGAGATGGATGGAGG - Intergenic
1144456444 17:15422788-15422810 CTGGGCATCTAGATGGATGGTGG + Intergenic
1144818780 17:18056344-18056366 CTGAGTATCCAGAAGGTTGGGGG + Intronic
1145203217 17:20966041-20966063 CTGAGTTAACATATGGAAGGGGG - Intergenic
1146500800 17:33362827-33362849 CTGAATAAGCAAATGAATGGAGG + Intronic
1148479300 17:47949666-47949688 CTGGGTGGCCAGATGGATGTGGG - Intergenic
1150525148 17:65915218-65915240 CTGAGCAACCAGGTGGATGGTGG - Intronic
1150733047 17:67712426-67712448 TTGAGTGACCAGGTGGATTGGGG - Intergenic
1151447003 17:74173380-74173402 CTGAGTAGCCAAAGGGGTGGAGG + Intergenic
1151862067 17:76771728-76771750 CTTAGTAACCAGTTGCGTGGTGG + Intronic
1154304716 18:13222189-13222211 ATGAGTAAATAAATGGATGGGGG - Intronic
1154459810 18:14570828-14570850 CTGAGTCTGCAGATGAATGGAGG + Intergenic
1157164136 18:45342585-45342607 CAGAGCAACCAGATGAATGCAGG + Intronic
1157701493 18:49763838-49763860 CTGAATAACCAGCTGGAGGCAGG - Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1163194154 19:15702824-15702846 CTGATTAACCAGATGGATGCAGG - Intergenic
1165642785 19:37403993-37404015 CTGAATATCAAGATAGATGGTGG - Intergenic
1166545439 19:43632143-43632165 CTGAGCAACCAGGTGGATGGTGG - Intronic
1167144075 19:47671796-47671818 ATGGGTAGCTAGATGGATGGAGG + Intronic
926299156 2:11589835-11589857 CTGAGCAGCCAGGTGAATGGTGG + Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
929585963 2:43114676-43114698 TTGAGTAGCCAGGTGGGTGGTGG - Intergenic
929866220 2:45719541-45719563 CTGAGTGACTGGATGGATAGTGG + Intronic
931428601 2:62192673-62192695 TTCTTTAACCAGATGGATGGTGG - Intergenic
932612433 2:73209859-73209881 TTGAGTAACCAGGTGGACGGTGG - Intronic
936018240 2:108975506-108975528 CTTGGTGACCAGATGGATGCCGG + Intronic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
938230300 2:129653343-129653365 ATGAGTACCCAGATGGAGGGTGG + Intergenic
938717080 2:134030500-134030522 CTGCCTGACCAGATGGATGTGGG + Intergenic
939995872 2:148919017-148919039 CTGAGTAACTAGGTGATTGGTGG + Intronic
940327740 2:152443165-152443187 ATGGGGAACCAGATGGGTGGTGG + Intronic
941368739 2:164637987-164638009 ATAAGTAACCAACTGGATGGAGG + Intergenic
942550542 2:177111709-177111731 CAGAGTCTTCAGATGGATGGAGG - Intergenic
942623892 2:177878097-177878119 CTGTGTGACCAGATGAATGTAGG + Intronic
942625978 2:177901251-177901273 CTGAGTTAGCTCATGGATGGGGG - Intronic
945485076 2:210385724-210385746 CTGAGCCTCCAGATGGATGCAGG - Intergenic
946305395 2:218854155-218854177 CTGATTAACTGGATGGATGCTGG - Intergenic
947136353 2:226980031-226980053 GTGACTAACCAGAGGGATAGTGG + Intronic
947179902 2:227402669-227402691 CTGAGTGACCAGGTGGTTAGAGG + Intergenic
1169730461 20:8780221-8780243 CTGAGTACCCAGAGTGATTGGGG - Intronic
1169949889 20:11032224-11032246 CTGGGAAACCAGTGGGATGGTGG + Intergenic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1172203989 20:33148968-33148990 ATGAGTAGGTAGATGGATGGAGG + Intergenic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1173354110 20:42270823-42270845 CTGAGAAGCTACATGGATGGTGG - Intronic
1173355398 20:42282888-42282910 ATGAGTGAGCAGATGGAAGGAGG + Intronic
1174188204 20:48721918-48721940 CTGAGCAACCAGAAGGACAGAGG + Intronic
1174289243 20:49496013-49496035 CTGAGTATATAGATGGATGAGGG - Intergenic
1175423641 20:58851223-58851245 CTGCGTGGCCACATGGATGGTGG + Intronic
1176130692 20:63495607-63495629 CAGAGTCCCCAGATAGATGGGGG - Intronic
1178184875 21:30207939-30207961 CTGAGTATGGAGATGGATTGGGG + Intergenic
1182060690 22:27395040-27395062 GTGAGTGAGCAGATGGATGAGGG + Intergenic
1182950560 22:34371442-34371464 CTCAGGAACCAGATTAATGGAGG - Intergenic
1183283525 22:36947621-36947643 CTGAGTGACGAGATGGGAGGAGG - Intergenic
949732706 3:7132178-7132200 CTCAGTAACCATATTGTTGGGGG - Intronic
950089083 3:10282181-10282203 CTGATGAATCAGTTGGATGGTGG + Intronic
953411747 3:42694218-42694240 CTGAGCAACTGAATGGATGGTGG - Intronic
955009448 3:54999986-55000008 CTGTGTGCCCACATGGATGGTGG - Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
959128263 3:102317758-102317780 CTTTGTAACAACATGGATGGAGG - Intronic
959585762 3:108023691-108023713 CTGAGTATCCAGATTGAGGAGGG - Intergenic
959999878 3:112720014-112720036 AGGAGTAACCAGATAAATGGTGG - Intergenic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
966005595 3:175007919-175007941 CTCAGTTATCAGATCGATGGTGG - Intronic
967870781 3:194227213-194227235 CTGAGTAACTAGGTGGATGTTGG - Intergenic
969560100 4:7941357-7941379 CTGAGCAGCTAGGTGGATGGAGG - Intergenic
969974645 4:11086007-11086029 CTGACCAAACAGATGAATGGAGG - Intergenic
971283885 4:25268155-25268177 CTGAGGAACCAGATAGACTGAGG + Intronic
973553380 4:52057509-52057531 CTGGGTACCCAGAGGAATGGTGG - Intronic
973769282 4:54191788-54191810 CTGAGCAACCAGAAGAATGCAGG + Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
980254887 4:130366333-130366355 CTGAGTAATCAGGTGAATAGTGG - Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG + Intronic
981048870 4:140291738-140291760 CTGAGAAATCAGATGGATCCTGG - Intronic
981236242 4:142419084-142419106 TTGAGTAACTAAGTGGATGGTGG + Intronic
984850306 4:184146867-184146889 GTTAGTAACCAGATGGAGGAGGG - Intronic
984983979 4:185309543-185309565 ATGAGAAGCCAGAGGGATGGTGG - Intronic
985708543 5:1415261-1415283 CTGAGAAACCAGAGAGCTGGAGG + Intronic
987591842 5:19940187-19940209 CTCAGTAATCAGATGAATAGTGG - Intronic
988943877 5:36174686-36174708 CAGAGTAACCAGATAGAATGTGG + Intronic
990951833 5:61305961-61305983 ATGAGAAAACAGAGGGATGGGGG - Intergenic
991377981 5:65986202-65986224 CTGAGTAAGCAGCTGGATATAGG - Intronic
995256095 5:110048539-110048561 CTTAGAAACCAGAGTGATGGAGG + Intergenic
995532485 5:113105552-113105574 CTGAGTAACTGGGTGGATAGGGG - Intronic
996876286 5:128243718-128243740 GTGAGTAAGTAGATGGATGATGG + Intergenic
999639278 5:153655356-153655378 ATGAGTTAATAGATGGATGGTGG - Intronic
1000125848 5:158243184-158243206 GTAAGAAACCAGATGCATGGAGG + Intergenic
1001815875 5:174669089-174669111 CCAGGTGACCAGATGGATGGTGG + Intergenic
1001931065 5:175673353-175673375 CTGAGCAACCAGGTGTTTGGAGG + Intronic
1002939964 6:1707503-1707525 GTGAGCAACCAGATGGAGGTGGG + Intronic
1004145734 6:13064340-13064362 CTGAGCAATTAAATGGATGGAGG + Intronic
1004357591 6:14943557-14943579 CTGATTAGCCAGATGGGTTGAGG + Intergenic
1004589441 6:17034788-17034810 CTGAGTAACCAAATAGTTGCTGG + Intergenic
1004590237 6:17043724-17043746 CTGAGTAACCAAATAGTAGGTGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1010259012 6:73794268-73794290 CTGAGGAACAAGGTGGACGGTGG - Intronic
1010368623 6:75081548-75081570 CTGAGTAACTTGGTGGCTGGTGG + Intergenic
1010641991 6:78340266-78340288 TTCAGTAACCAAATGGATGCTGG + Intergenic
1011195548 6:84775255-84775277 GCGAGCAACCACATGGATGGAGG + Intergenic
1011428966 6:87264707-87264729 CTGAAGAAGCAGATGGGTGGTGG + Intergenic
1011710151 6:90044786-90044808 TTAAGTGACCAGATGAATGGGGG + Intronic
1012945322 6:105459859-105459881 CTGAGTGACCAGAATGATGAAGG - Intergenic
1013864847 6:114682992-114683014 CTGAGATACCAGAAAGATGGCGG - Intergenic
1014651943 6:124050608-124050630 CTTAGTTACCACATGGATTGGGG - Intronic
1016315740 6:142784608-142784630 GTCAGTAACCAGATGAATGTGGG + Intronic
1017200400 6:151747314-151747336 CTGAATAAGCAGATGGGTTGTGG + Intronic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1020471174 7:8536882-8536904 ATGAGTATCCAGATAAATGGTGG + Intronic
1021762847 7:23918158-23918180 TTGAATAACTGGATGGATGGAGG - Intergenic
1022312728 7:29212466-29212488 CTGAATAAGCAGATCCATGGAGG - Intronic
1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG + Intergenic
1026275413 7:68871851-68871873 GTGAGTAGATAGATGGATGGAGG - Intergenic
1030667841 7:112300797-112300819 CTGAGTGACCAGGAGAATGGTGG - Intronic
1030957150 7:115868391-115868413 GTGAGTAACCAGAAGTCTGGGGG + Intergenic
1033045676 7:137960238-137960260 CTATGTAACCAGACAGATGGTGG - Intronic
1034716616 7:153248960-153248982 ATGAGTAACAAGATGGATATAGG + Intergenic
1035066394 7:156108327-156108349 CTGCAAAACCAGATGGATGCTGG - Intergenic
1039947952 8:42146188-42146210 TTGAGTAGCTGGATGGATGGTGG + Intergenic
1040425527 8:47281261-47281283 CTGACTGATCAGATGGTTGGTGG + Intronic
1040789509 8:51209459-51209481 CTCAGTTAACAGATGGATTGTGG + Intergenic
1041318952 8:56593942-56593964 TTGAGCAACTAGGTGGATGGAGG + Intergenic
1044496251 8:92888086-92888108 CTGTGTAACCAGATGGGTCTGGG - Intronic
1047773957 8:128053811-128053833 CTGAGCAACCAGAAGGGTTGGGG + Intergenic
1048435130 8:134409272-134409294 CTGAGGAAGCAGATGGATGTTGG + Intergenic
1048450636 8:134530497-134530519 CTCTGAAATCAGATGGATGGTGG - Intronic
1048491265 8:134895978-134896000 CTGAACAACCAGAAGGATGGTGG - Intergenic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1049255877 8:141613531-141613553 CTGAGCCACCAAATGGGTGGTGG - Intergenic
1050704726 9:8384244-8384266 CTGGGCAACCACATGGAAGGAGG - Intronic
1051200674 9:14618951-14618973 ATGTCTAAACAGATGGATGGTGG - Exonic
1055464661 9:76552490-76552512 CTTGGAAACCAGATGAATGGGGG + Intergenic
1056979944 9:91300401-91300423 TTGAGTAACTTGATGAATGGAGG - Intronic
1057159272 9:92875060-92875082 CTGAGAAAACAGATGGGTAGAGG + Intronic
1057633648 9:96742100-96742122 CTGTGTAACCACATAGATGGAGG + Intergenic
1057946985 9:99338471-99338493 CGGAGTCACTGGATGGATGGTGG + Intergenic
1058435719 9:104961232-104961254 CTGACTATCCATATGGATAGTGG - Intergenic
1059388079 9:113980765-113980787 GTGAGCAACCAGCTGGATGGAGG + Intronic
1060994430 9:127868101-127868123 CTGAGTCACCAGGTGGAGTGGGG + Intronic
1061654488 9:132078641-132078663 CTTAGTAACCAGATGGAAAGAGG - Intronic
1062112300 9:134788765-134788787 ATGAGTAGACAGGTGGATGGTGG + Intronic
1186497592 X:10024085-10024107 CATTGTAACCAGGTGGATGGAGG - Intronic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1187190680 X:17032016-17032038 CTCAGGAACCAGATAGATGGTGG + Intronic
1187279600 X:17847743-17847765 ATAAGTATCCATATGGATGGGGG + Intronic
1191873820 X:65773445-65773467 CTGAATAAGCAGATCCATGGAGG + Intergenic
1196518598 X:116644247-116644269 CTGAGTAACTAGGTGGATTATGG - Intergenic
1196570169 X:117256816-117256838 TTGAGTAAAAAGATGAATGGTGG + Intergenic
1196811848 X:119635151-119635173 TTGGGCAACCAGGTGGATGGTGG + Intronic
1198517089 X:137420535-137420557 TTGAGCAACCAGATGGATGGTGG - Intergenic
1199731094 X:150632779-150632801 CTGGATAACCAGACCGATGGTGG + Intronic