ID: 1158582258

View in Genome Browser
Species Human (GRCh38)
Location 18:58694051-58694073
Sequence TGGTAGGAAAGGTGGAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 430}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158582258 Original CRISPR TGGTAGGAAAGGTGGAAAAT GGG (reversed) Intronic
902830699 1:19010495-19010517 TGGAAGGAGAGGAGGGAAATGGG + Intergenic
903790204 1:25887580-25887602 TGGAAGAAAAGGAAGAAAATGGG + Intronic
904597074 1:31653647-31653669 TGGTACCAAAGGTGAAAAAGGGG - Exonic
905891253 1:41519846-41519868 TGGAAGGATAGATGGAGAATGGG + Intronic
906798661 1:48717579-48717601 TGGTAGAAAAAGTGGAAAAGTGG - Intronic
907333958 1:53688442-53688464 TGGTGGGAAAGGTGGCACAGAGG - Intronic
907516552 1:54996776-54996798 AGGTAGGAACTCTGGAAAATGGG - Intergenic
908008326 1:59749468-59749490 TGGCAGGAGAGTTGGAGAATTGG + Intronic
912304627 1:108554751-108554773 AGGTAGGAAAGGGGGAAAAGTGG + Intergenic
913516883 1:119612578-119612600 TGGGAGCAGAAGTGGAAAATCGG - Intergenic
915274774 1:154780846-154780868 GGGAAGCAAAGGTGGAAAAATGG + Intronic
916340905 1:163733281-163733303 TGGCATAAAAGTTGGAAAATAGG - Intergenic
916455868 1:164970484-164970506 TGGTCGGGAAGGTGGAAGGTAGG - Intergenic
916666886 1:166975122-166975144 TGGTCAGTAAGGAGGAAAATGGG + Intronic
917187533 1:172376946-172376968 TGTTAAGAAAGCTGTAAAATGGG + Intronic
917211407 1:172635477-172635499 GAGAAGGAAAGCTGGAAAATTGG - Intergenic
917782306 1:178411394-178411416 TGGGAGGAAGGGTGGGAGATGGG + Intronic
918656902 1:187038147-187038169 TGGTAGGGAGGCTGGAAAAAAGG + Intergenic
918900613 1:190411973-190411995 TGGTAGGAAAGGAGGATGCTGGG - Intronic
919506443 1:198404402-198404424 TGTTAGAAAAGGGGGCAAATAGG + Intergenic
920297849 1:204970203-204970225 TGCTAGGGAAGGTGGTAAAGTGG - Intronic
922173369 1:223176060-223176082 TGGCTGGAAATGTGGAACATTGG + Intergenic
922209217 1:223474739-223474761 TAGAAGGAAAGTGGGAAAATTGG + Intergenic
922455465 1:225770490-225770512 CGGTAGGGAAGGTGGGAAAGGGG - Intergenic
923278263 1:232417281-232417303 TGGTAGGTAGCATGGAAAATTGG - Intronic
924410462 1:243799183-243799205 AGGTAGGAAAGAAAGAAAATGGG + Intronic
1063504890 10:6588635-6588657 TCCTAGGAAAGGTGGAAGCTTGG - Intergenic
1063912236 10:10842843-10842865 TGGAAGAAAATGTGGAGAATTGG + Intergenic
1064115976 10:12577805-12577827 GGGTGGGGAAGGAGGAAAATGGG - Intronic
1065496737 10:26336948-26336970 TGGTGTGAAAGGTGGAATGTTGG - Intergenic
1068077900 10:52280414-52280436 TGGTAGGCAAGCTCTAAAATAGG + Intronic
1068255932 10:54510819-54510841 TGGCAGGAGACGTGGAAAAAAGG - Intronic
1071709278 10:88033549-88033571 TGGCAGGAAATGTTGATAATGGG - Intergenic
1071827088 10:89336127-89336149 AGGGAGGAAAGAAGGAAAATAGG + Intronic
1071827108 10:89336188-89336210 AGGGAGGAAAGAAGGAAAATAGG + Intronic
1072459260 10:95604573-95604595 TGGTAAGGGAGGAGGAAAATCGG - Intergenic
1073060802 10:100732358-100732380 TGGGAGGAAAGGAGGAAAAAAGG - Intergenic
1073823397 10:107291426-107291448 TGGTACCTAAGGTGGAAGATAGG + Intergenic
1073906668 10:108288804-108288826 TGATAAAAAAGGTGGATAATAGG - Intergenic
1074079863 10:110158975-110158997 TGGTAGGTAAGGTGGTATCTGGG - Intergenic
1075981946 10:126747707-126747729 TGATAGTAAAGGTGAAACATTGG + Intergenic
1076084785 10:127617690-127617712 TGGGCAGAAAGGTGGAGAATGGG + Intergenic
1077828934 11:5842112-5842134 TGGTAGGAAAAGTGGCAATCAGG - Intronic
1079462703 11:20697966-20697988 TGGCAGGAAATCTGGAAGATCGG - Intronic
1079543406 11:21603403-21603425 TGGGAGAAAAGGGGGAAGATCGG + Intergenic
1079617601 11:22514243-22514265 TGCTAGAAAAAGTGAAAAATTGG - Intergenic
1079645597 11:22860702-22860724 GGGTAGAAAAGGTGGGAAATTGG - Intergenic
1079967985 11:27002301-27002323 TGGAATTAAAGATGGAAAATTGG - Intergenic
1080007612 11:27426362-27426384 TGGGAGGAATGATGTAAAATTGG + Intronic
1080313900 11:30926440-30926462 CTGTCAGAAAGGTGGAAAATGGG + Intronic
1080709913 11:34737091-34737113 TGGAGGGCAAGGTGGAAGATGGG + Intergenic
1080892611 11:36422423-36422445 TGTTGGGAAAGGTGAAAGATGGG + Intronic
1081691657 11:45082456-45082478 TGGTAGGAAAGGCTGATAAGAGG - Intergenic
1082807467 11:57460120-57460142 TGGAAGGAAAAGTGGAATCTTGG + Intergenic
1083119149 11:60493401-60493423 TGCTAAGAAAGGTGAATAATAGG + Intronic
1083471223 11:62885371-62885393 TGGTGGGAAAGGGGGCAGATGGG + Intronic
1083738148 11:64693515-64693537 TGGTAGAAAAGGGGGAAAGATGG + Intronic
1084134429 11:67165620-67165642 ATGTAGCAAAGCTGGAAAATAGG + Intronic
1084747971 11:71185323-71185345 AGGTAGGAAGGGTGGAGAGTAGG - Intronic
1086157146 11:83679924-83679946 GGGTAGGGAAGGTGGCAAAAAGG - Intronic
1087237153 11:95732988-95733010 TGGAAGGAAAGAAGGAAAAAAGG + Intergenic
1087808378 11:102581382-102581404 TGGTAGGCAAGGTTGAGAAGGGG + Intronic
1089128360 11:116193150-116193172 GGGTGGGGAAGGTGGAAAAGTGG + Intergenic
1089219431 11:116858521-116858543 TGGGAGGGAAGGTGGGGAATTGG + Intronic
1089492143 11:118890491-118890513 TTGGAGGAAGGGTGGAAATTAGG + Intronic
1090538876 11:127678486-127678508 GGGTAGGAAAGAAGGAAAGTTGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091081173 11:132669782-132669804 TATTGGGAAAGATGGAAAATGGG - Intronic
1091334486 11:134756153-134756175 TGGAGAGAAAGGAGGAAAATAGG + Intergenic
1091852392 12:3710492-3710514 TGGTAAGAAAGATGGGAAGTTGG + Intronic
1091941093 12:4483109-4483131 TGGTAGTAGAGCTGGAAAAGAGG - Intergenic
1091993126 12:4973017-4973039 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993147 12:4973099-4973121 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993158 12:4973140-4973162 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993169 12:4973181-4973203 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993179 12:4973222-4973244 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993190 12:4973263-4973285 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993200 12:4973304-4973326 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993210 12:4973345-4973367 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993221 12:4973386-4973408 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993232 12:4973427-4973449 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993242 12:4973468-4973490 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993253 12:4973509-4973531 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993264 12:4973550-4973572 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993285 12:4973632-4973654 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993296 12:4973673-4973695 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993307 12:4973714-4973736 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993318 12:4973755-4973777 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993339 12:4973837-4973859 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993349 12:4973878-4973900 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993359 12:4973919-4973941 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1091993369 12:4973960-4973982 AGGTAGGAGAGGAGGAGAATGGG - Intergenic
1092091144 12:5804577-5804599 TGGTAGAATAGGTGGGAACTAGG - Intronic
1093487627 12:19668822-19668844 TGGAAGGGAAGGAGGAAAAAAGG - Intronic
1093521626 12:20057782-20057804 AGGAAGGAAGGGAGGAAAATAGG - Intergenic
1093607626 12:21111859-21111881 TGGGAGAAAAGGTGGAATATCGG - Intronic
1093725527 12:22504008-22504030 TGGGAGGAAAGGCAGAGAATGGG + Intronic
1094779997 12:33780000-33780022 TGGTGGGAAATGTTGACAATAGG - Intergenic
1095429699 12:42119915-42119937 TAGTTTGAAAGGAGGAAAATTGG - Intronic
1095517171 12:43019257-43019279 TGGAAGCAAGGGTGGGAAATTGG + Intergenic
1097290458 12:57910191-57910213 TGGGAGGAAAGGTGGAGAGATGG + Intergenic
1097617684 12:61902940-61902962 TGGGATGACAGGTTGAAAATGGG - Intronic
1097979921 12:65727777-65727799 TGGGAGGAGAGGTGGAGAATTGG - Intergenic
1098151057 12:67547096-67547118 GAGTCAGAAAGGTGGAAAATGGG - Intergenic
1099669364 12:85670528-85670550 TGGTAGGAAAGGCATAAATTTGG + Intergenic
1099741759 12:86646212-86646234 TGGTTAGAAAGGTGGTAAAATGG + Intronic
1099813471 12:87616290-87616312 TGTTAGTAAAGGGGGAAACTTGG + Intergenic
1100047966 12:90407923-90407945 TGGTTGGAAAGGTGAAGAAAAGG - Intergenic
1101788520 12:107907775-107907797 AAGTAGGAAAGGAGAAAAATAGG + Intergenic
1102407906 12:112690143-112690165 TTGTAGAAAAGTTGGAAAATTGG + Intronic
1103038185 12:117673249-117673271 AGGAAGGAAGGGTGAAAAATTGG + Intronic
1104351513 12:128048045-128048067 TGGAAGGAAGGGAGGAGAATTGG - Intergenic
1106209253 13:27625787-27625809 TGGTAGGAAAGTGCAAAAATAGG + Intronic
1106582722 13:31031872-31031894 TGGTAAGAAAGGAGGAAAAGCGG - Intergenic
1106837771 13:33654394-33654416 TGATATGAAATGTGCAAAATAGG + Intergenic
1106894883 13:34289254-34289276 TGGTAGGATAAGTGGAAATGGGG - Intergenic
1108892840 13:55282635-55282657 TGGAAGGAAAGGTGAAACACAGG - Intergenic
1109639229 13:65165333-65165355 TGGTATAAAAGATGAAAAATGGG - Intergenic
1110198638 13:72821177-72821199 TGTTAGGAATGGTGAGAAATGGG + Intronic
1110286796 13:73759149-73759171 TGATAGGAGATTTGGAAAATGGG - Intronic
1110779416 13:79447586-79447608 TAGGAGGAAAGGGTGAAAATGGG - Intergenic
1112951283 13:104999708-104999730 CCTTAGAAAAGGTGGAAAATTGG - Intergenic
1113147498 13:107224506-107224528 TGGTAAAAAAGGTAAAAAATTGG + Intronic
1113205040 13:107907426-107907448 AAGTGGGAAAAGTGGAAAATGGG - Intergenic
1114189235 14:20428494-20428516 TGGGAGGACAGTTGGAAAAATGG - Intergenic
1114485577 14:23059483-23059505 AGGTAGGAAAGGCAGAGAATAGG + Intronic
1116759286 14:48991231-48991253 TTGTTGGAAATGTGGAACATGGG + Intergenic
1117102595 14:52365602-52365624 TGCTAGGGAAGGTGGAAATTAGG + Intergenic
1117737236 14:58780387-58780409 TGATGGGAAAGGTGGAGAGTAGG - Intergenic
1117824632 14:59688463-59688485 GGGTGGGACAGGTGGCAAATGGG - Intronic
1118128362 14:62935058-62935080 TACTATGAAAGGTGGAAAAGTGG + Intronic
1118706018 14:68480901-68480923 TGGTAGGATAGCTGGAAATAGGG - Intronic
1119274963 14:73346835-73346857 CAGGAGCAAAGGTGGAAAATAGG - Intronic
1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG + Intronic
1120600688 14:86502623-86502645 TGGGAAGAAACATGGAAAATCGG + Intergenic
1120665628 14:87303289-87303311 GGTTGGGAAAGGTGGGAAATAGG + Intergenic
1120734133 14:88034571-88034593 TGGTAGGAACTGTGGCAAATAGG - Intergenic
1121708708 14:96020576-96020598 TGGAAGGATATGAGGAAAATGGG + Intergenic
1122571888 14:102709400-102709422 TTACAGGAAATGTGGAAAATAGG - Intronic
1122830145 14:104392000-104392022 TGTTATGGAAGGTGGAAATTAGG + Intergenic
1124150746 15:27175673-27175695 TGGTAGGAAGCATGGCAAATGGG + Intronic
1124783169 15:32655399-32655421 GGGGAGGAAAAGGGGAAAATGGG - Intronic
1125174537 15:36805578-36805600 TGGTAGAAGAGGTGTAAAATAGG - Intronic
1125251540 15:37710929-37710951 TGGAAGGAAAGGAGGAAAAGAGG - Intergenic
1126206734 15:46053829-46053851 TGGTAGGGAATGTTGATAATAGG - Intergenic
1127473794 15:59313639-59313661 TGGCAGGAATGGTGGAAGTTGGG - Intronic
1128948372 15:71848085-71848107 TGAGAGGAAGGGTGGCAAATGGG + Intronic
1129206174 15:74038200-74038222 GGGAAGGAAAGGTGGAGAACAGG + Intronic
1129367294 15:75064153-75064175 TGTGAGCCAAGGTGGAAAATTGG + Intronic
1129387345 15:75203060-75203082 AGGTAGGGAAGGTGGGAGATGGG + Intronic
1130791964 15:87164869-87164891 AGGTAGGAAAGGTGGCAGGTAGG - Intergenic
1131404347 15:92151894-92151916 TGTTTGTAAAAGTGGAAAATTGG + Intronic
1131615120 15:94008113-94008135 AGGTAGGAAAGGCTGAAAATTGG - Intergenic
1131643296 15:94315084-94315106 TGGTGGGAAGGGTGGAGAACAGG + Intronic
1131792970 15:95984702-95984724 TTGAAAGAAAGCTGGAAAATAGG + Intergenic
1131844690 15:96476690-96476712 AGATAGGGAAGGTGGGAAATGGG - Intergenic
1134465057 16:14468363-14468385 TGGTGGGAAAGGTGGACAGTCGG + Intronic
1135006595 16:18829229-18829251 AGGTAGGAAACTTGAAAAATGGG - Intronic
1135199981 16:20429101-20429123 TGGGAGGAAAGCTGGAACCTGGG - Intronic
1135218720 16:20594507-20594529 TGGGAGGAAAGCTGGAACCTGGG + Intergenic
1139877524 16:70158075-70158097 TGGGGGGAAAGGAGGAAAAGCGG - Exonic
1139933420 16:70548631-70548653 AGGTGGGAAAGGGGGAACATAGG + Intronic
1140678323 16:77357262-77357284 TGGAAGGAATGCTGGAAAAATGG - Intronic
1140771194 16:78205621-78205643 TGGATGGAAGGGTGGATAATTGG - Intronic
1141650215 16:85388741-85388763 AGGAAGGAAAGATGGAAAAAGGG + Intergenic
1141924116 16:87156000-87156022 TGGGAGGGACGATGGAAAATGGG + Intronic
1143487648 17:7263302-7263324 GGGTGGGAAAGGTGGAGGATAGG - Intronic
1144033720 17:11344932-11344954 TGGTAGGAAAGGTCGGAAAGAGG - Intronic
1144344115 17:14334567-14334589 TGGTAGGAAATATTGATAATGGG - Intronic
1145868348 17:28255047-28255069 AGGGAGGAAAGGTGGAAGAAAGG + Intergenic
1146488138 17:33260632-33260654 TGGGATGAAAGGTGGCAAGTGGG + Intronic
1146503704 17:33386353-33386375 TGGTAAGAGAGGTGGAATATAGG - Intronic
1148616272 17:49002766-49002788 TTGGAGGAAAGGTGGAAACTGGG + Intronic
1148729395 17:49822748-49822770 TTGTAGGAAACGTCCAAAATAGG - Intronic
1149364898 17:55933535-55933557 TGCTGGGAATGGTGGAATATAGG + Intergenic
1149700465 17:58650801-58650823 CAGTGGGATAGGTGGAAAATTGG + Intronic
1150006579 17:61473535-61473557 TGGGAGGAAAGGAGGAAAGAGGG - Intronic
1150848235 17:68680602-68680624 TGGAAGGAAAGGGGAGAAATTGG + Intergenic
1151161791 17:72172166-72172188 TGATAGGAAAGCTGGGAACTGGG - Intergenic
1151293837 17:73169204-73169226 TGGAAGGAAAAGAGGAAGATTGG - Intronic
1151501855 17:74495081-74495103 TGGTAAGGAAAGTGGGAAATGGG + Intergenic
1151579712 17:74971286-74971308 TGGCAGGGAAGGTGGCAAGTGGG - Intronic
1151763947 17:76122529-76122551 TGGAAGGAAAGCTGGGAAGTAGG + Intergenic
1155845581 18:30701606-30701628 TACAAGGAAATGTGGAAAATTGG + Intergenic
1156378673 18:36537271-36537293 TGCTAAGAAAGCTGGAAAACTGG - Intronic
1156623439 18:38880681-38880703 AGGAAGGAAAGGTGGAAGCTAGG + Intergenic
1157120146 18:44901557-44901579 AGGTAGGGAAGGTGGGGAATGGG + Intronic
1157150942 18:45217099-45217121 TGCAAGGAAAGGAGGAAAATTGG - Intronic
1157450446 18:47782808-47782830 TGGAAGGAAAGGAGGAACAGGGG - Intergenic
1157648054 18:49298003-49298025 TGCTAGGAAAGGGGAAAAAAGGG + Intronic
1158582258 18:58694051-58694073 TGGTAGGAAAGGTGGAAAATGGG - Intronic
1158923056 18:62215624-62215646 TGTTAGGAATGCTGCAAAATAGG + Intronic
1159887914 18:73927090-73927112 TGGTGGGAAGGGTGGCAAAGGGG + Intergenic
1160350782 18:78176543-78176565 TGCTAGGCAAGGTGGGACATGGG + Intergenic
1160598562 18:79994869-79994891 TGGCAGGCAAGGAGGAGAATAGG - Intronic
1160782884 19:885598-885620 TGCTGGGAAAGGCAGAAAATGGG + Intronic
1161340567 19:3739738-3739760 CTCTGGGAAAGGTGGAAAATTGG - Intronic
1161413512 19:4130808-4130830 TGGTAGTAAAGATAGAGAATGGG - Intergenic
1163493909 19:17633553-17633575 TGGTTGGATGGGTGGATAATGGG - Intronic
1163868767 19:19800271-19800293 TGCTAGGAAATGTGAAGAATTGG + Intronic
1164123012 19:22285203-22285225 CTGGAAGAAAGGTGGAAAATGGG + Intergenic
1164769221 19:30795484-30795506 TACTAGGAAAGGGAGAAAATTGG - Intergenic
1164878718 19:31712764-31712786 TGGTGGGAAAGGAAGAAAATGGG + Intergenic
1165810216 19:38607589-38607611 TGGAAGGAAAGAAGGAAAGTGGG + Intronic
1165836360 19:38759054-38759076 TGGTATAAAAGATGGAAAATGGG - Intronic
1166117293 19:40663629-40663651 TGGGAGGGAAGATGGGAAATGGG + Intergenic
1168054677 19:53856005-53856027 GGGGAGGAACGCTGGAAAATGGG - Intergenic
925085530 2:1104925-1104947 AGGTAGGAAAGAAGGGAAATGGG + Intronic
925211252 2:2048739-2048761 TGGAAGCAAAGTTGGAAAATAGG - Intronic
926643609 2:15264460-15264482 TAGTAGGAGAGATTGAAAATTGG - Intronic
926861476 2:17314766-17314788 TGGTAGGAATGGTGGTCACTGGG - Intergenic
927010471 2:18898577-18898599 TGGAAAGAAAGGTGGAAAGCTGG + Intergenic
927214027 2:20656103-20656125 TGGTAGAAAAGCTGGAAAATAGG + Intergenic
927230386 2:20818338-20818360 TGGTATGAAAGGGGAAAATTGGG + Intronic
927603776 2:24467540-24467562 TGGGAGAGAAGGTAGAAAATGGG + Intergenic
927999039 2:27507128-27507150 TGGGAGGAAAAGTGGCAAGTGGG - Intronic
928751993 2:34481540-34481562 TGGTAGAAAATGTAGAAAGTGGG + Intergenic
928788390 2:34918995-34919017 TGGTAGGAGATGTTGACAATGGG - Intergenic
931330338 2:61274706-61274728 TGGTAGAAATGCTGGAAAATTGG + Intronic
932168296 2:69528867-69528889 TGGTAGGAAATATGGGAAAATGG - Intronic
932463796 2:71900022-71900044 TGGTAGGAAAGGCTGACACTGGG - Intergenic
933146605 2:78861507-78861529 TGGAAGGGAAGGTAGAGAATAGG + Intergenic
933347635 2:81109471-81109493 TGGTAGGAATGTGGGAAAAATGG - Intergenic
934111562 2:88748072-88748094 TGGTTGGAAAAGTGGCAAAGAGG - Intronic
935850266 2:107211436-107211458 TGGTATCAAAGGTGGCAAAAAGG + Intergenic
938108124 2:128547038-128547060 TGGGCGGATAGGTGGATAATAGG - Intergenic
938565840 2:132517779-132517801 TTCTTGGAAAGATGGAAAATCGG + Intronic
938970707 2:136428718-136428740 TGGTAGGGAATGTTGACAATGGG - Intergenic
940253824 2:151708257-151708279 TGGTAAGAAAAGAAGAAAATGGG - Intronic
941000094 2:160193665-160193687 CAGAAGGAAAGGAGGAAAATAGG - Intronic
942913410 2:181273647-181273669 AGGTAAGAAAGAGGGAAAATGGG - Intergenic
943171064 2:184401050-184401072 TGCTAGGAAAGGAAGAAAAAAGG + Intergenic
943471356 2:188297851-188297873 TGGTAGCAAACGTGCAAATTTGG + Intronic
943575941 2:189631116-189631138 AGGGAGGAAAGGTGGAAAGAAGG + Intergenic
943696370 2:190938583-190938605 TGCTAGGAAACCTGGAAAAGGGG - Intronic
944330235 2:198457165-198457187 TGGGAGGATTGGTGGAAACTAGG - Intronic
944408535 2:199413547-199413569 TAGTAGGAAAAGTGGACATTGGG - Intronic
944988092 2:205202302-205202324 TGGAAGCAAAGGTGTAAAAATGG + Intronic
947037758 2:225878864-225878886 TGGAAGGAAAGTTGGAAAGAAGG - Intergenic
948263397 2:236620904-236620926 AGGTGGGAAAGGTAGAAAAAGGG + Intergenic
1169095150 20:2891160-2891182 TAGGAGAAATGGTGGAAAATAGG - Intronic
1169795374 20:9457071-9457093 TGGGATGAAAACTGGAAAATAGG - Intronic
1170398718 20:15957141-15957163 TGGCTGGAAAGGAGGATAATGGG + Intronic
1170975102 20:21156158-21156180 TGGTAACAATGGTGGAAACTAGG - Intronic
1171998927 20:31756330-31756352 TTGTATGATAGGTGGAAATTGGG + Intronic
1173541660 20:43857261-43857283 AGGGAGGAAAGGGGGAAAAAGGG + Intergenic
1174451471 20:50623435-50623457 AGGGAGCAAAGGTGGAGAATGGG + Intronic
1174840105 20:53893283-53893305 AGTTAGGAAAGATGAAAAATTGG + Intergenic
1177739797 21:25140388-25140410 TTTTAGAAAAGGTGGTAAATAGG + Intergenic
1177814817 21:25964540-25964562 TGTTATAAAAGGTAGAAAATAGG + Intronic
1178516612 21:33253438-33253460 TGGTAAAACAGGTGGAAACTTGG - Intronic
1178609102 21:34064886-34064908 GGGTAGGAAAGGGGAAAATTTGG + Intergenic
1179473180 21:41625804-41625826 TGGTAGCCAAGGCTGAAAATCGG + Intergenic
1180745511 22:18085995-18086017 TTTTAGAAAATGTGGAAAATAGG + Intronic
1180966920 22:19794546-19794568 AGGTAGGAAAGGAGGAAAAGTGG + Intronic
1181870427 22:25893951-25893973 TGGTTGGATAGGTGGAATAATGG - Intronic
1182004887 22:26951621-26951643 TGGTAGGGAAGGAGAAAAGTGGG + Intergenic
1182039059 22:27222240-27222262 TGGAAGGATAGGTGGATAAATGG + Intergenic
1185007662 22:48291927-48291949 TGATAGGAATGGAGGTAAATTGG - Intergenic
949892445 3:8743461-8743483 TGGGAGGAGAGGAAGAAAATGGG - Intronic
950728151 3:14932658-14932680 TTGTGGTAAAGGTGAAAAATAGG - Exonic
951724868 3:25746464-25746486 TTGTAGAAAATTTGGAAAATAGG - Intronic
953029237 3:39166847-39166869 AGACTGGAAAGGTGGAAAATGGG + Intergenic
953060008 3:39419405-39419427 TTGGAGGAAAGGAGGAAGATAGG - Intergenic
953531292 3:43741730-43741752 AGGTAGGATAGGTGGAGAACTGG + Intergenic
954608017 3:51928882-51928904 TGGTAGAGGAGGTGGAGAATTGG - Intergenic
954838297 3:53490491-53490513 TGGGAGGAAAAATGGAGAATGGG + Intergenic
955850058 3:63210784-63210806 AGGAAGGAAGGGAGGAAAATGGG - Intergenic
956508136 3:69964605-69964627 TGGTAGGGAATGTTGATAATGGG - Intronic
956789986 3:72672974-72672996 TGGGAGGAAAGGGGGAAAGAAGG + Intergenic
958944051 3:100344900-100344922 TGACAGGAGAGGTGGAAAGTAGG - Intronic
959449643 3:106483010-106483032 TGGTAGGAAAGATAGATAAAAGG + Intergenic
959558632 3:107753255-107753277 GGGAAGGAAGGGTGGAAAACTGG - Intronic
959953067 3:112203088-112203110 TGGTAGGATAAGTGCAAAACAGG - Intronic
960029406 3:113042266-113042288 GAGTAAGAAAGTTGGAAAATAGG - Intergenic
961201044 3:125045661-125045683 TGGAAGGATGAGTGGAAAATTGG - Intronic
961227975 3:125271103-125271125 TGTGAGGAAAGTTGGAAATTTGG - Intronic
963257355 3:143159065-143159087 TTGTAGGAAACATGGAAAAGGGG - Intergenic
963313509 3:143733802-143733824 TGGTAGTATTGGTGGAAAGTGGG - Intronic
963633158 3:147759442-147759464 GGGAAGGAAGGGTGGAAAAAAGG - Intergenic
964037850 3:152220302-152220324 TGGCAGGAAAGGTGGAGAAATGG - Intergenic
964508098 3:157421576-157421598 TGGAAGGAAATGTGGAGAAAGGG - Intronic
964864308 3:161238517-161238539 TGGTGGAAAAGGTTCAAAATAGG + Intronic
965129977 3:164684924-164684946 TAGTAGGAAAGATGGATAGTAGG + Intergenic
965264870 3:166530614-166530636 TGGTAGGCAAGGTGAAGTATGGG + Intergenic
966747609 3:183292930-183292952 AGGCAGGAAAGGAGGAAAAGAGG + Intronic
967918929 3:194600058-194600080 TGGTAGAAAATTTGGAAAAGGGG - Intronic
969386176 4:6850016-6850038 TTTTAGAAAAGGTAGAAAATTGG + Intronic
969508770 4:7605212-7605234 TCGTTGGAAAGGAGGAAAAGGGG + Intronic
969924192 4:10570245-10570267 TGGGTGGAAAGTTGGAAAATGGG - Intronic
971018079 4:22508993-22509015 TGGGAGAAAGGGTGGAACATGGG - Intronic
971133170 4:23836260-23836282 CGGAAGGAAAGGTAGAAAACAGG + Intronic
971365289 4:25972203-25972225 TGGAAGGAAGGGTGGAAACCAGG + Intergenic
971434037 4:26600544-26600566 TGAAATAAAAGGTGGAAAATTGG + Intronic
971752548 4:30668941-30668963 TGTTAGGAAAGTGGGAAATTTGG - Intergenic
972365776 4:38373085-38373107 TGGTAGGAGAGCTGCAGAATAGG - Intergenic
972803675 4:42505393-42505415 GGGCAGTAAATGTGGAAAATAGG - Intronic
972951489 4:44329406-44329428 TATTAGGAAATGTGTAAAATGGG - Intronic
973937047 4:55856972-55856994 TGGAAGGGAAGGTGGAAACGAGG - Intronic
974266638 4:59594359-59594381 TGGTAGAGATTGTGGAAAATTGG + Intergenic
974332167 4:60495329-60495351 TGGGAGAAAAGGTGAAGAATGGG - Intergenic
974861443 4:67526601-67526623 TGGAAGGAACTGTGTAAAATTGG - Intronic
975766055 4:77668804-77668826 TGGGAGGAAAGAAAGAAAATGGG - Intergenic
976361622 4:84185429-84185451 TGGGAGGAAGAGTGGAAAAGTGG - Intergenic
977345720 4:95813691-95813713 TGGAAGGGAAGGTTGAAAATGGG + Intergenic
977551718 4:98449939-98449961 AGCTTGGAAAGCTGGAAAATGGG - Intergenic
977839691 4:101687554-101687576 TGGTAGCAAAGGTGCAAACCTGG + Intronic
977856564 4:101902069-101902091 AGATAGGAATGGTGTAAAATTGG - Intronic
978524836 4:109654863-109654885 TGTTTGGAAAGTTGGAGAATTGG - Intronic
978688380 4:111477417-111477439 AGGTAGGAAGGGCTGAAAATAGG - Intergenic
978698418 4:111612521-111612543 TGGTGGGAAATGTTGATAATGGG - Intergenic
980000965 4:127487613-127487635 TGGTAGGGAACATGGAAAATTGG + Intergenic
980229387 4:130029522-130029544 TAGTGGGAAAAGTGGATAATGGG + Intergenic
980348398 4:131654963-131654985 TGGTAGAAAATGTGGTAAATTGG + Intergenic
980909974 4:138985488-138985510 TGGGAGGAAAGTTGATAAATTGG - Intergenic
980979914 4:139645850-139645872 TGGTATTAAAAATGGAAAATAGG - Intergenic
981054103 4:140342118-140342140 TGGGAGATATGGTGGAAAATAGG - Intronic
981499822 4:145438179-145438201 TCTTATGAAAGGTGCAAAATGGG + Intergenic
981756655 4:148147202-148147224 ATGGAGGAAAGGTGGGAAATAGG - Intronic
981854315 4:149269286-149269308 TGTTAAGAAAAATGGAAAATAGG - Intergenic
981854363 4:149270189-149270211 TGTTAAGAAAAATGGAAAATGGG - Intergenic
984850668 4:184149875-184149897 TGGGAGGAAGGAGGGAAAATAGG - Intronic
984950508 4:185004442-185004464 AGGAAAGAAAGGGGGAAAATGGG - Intergenic
985620200 5:950869-950891 TAATAGGAAGGGTGGAAAGTGGG + Intergenic
985665489 5:1179793-1179815 ATATAGGAAATGTGGAAAATGGG - Intergenic
985849793 5:2380635-2380657 TGCTGGGAAAGGTGGAACAATGG + Intergenic
986163613 5:5252937-5252959 TGATAAGAAATGTGGATAATGGG - Intronic
987075322 5:14376669-14376691 TGGTTAGAACAGTGGAAAATAGG - Intronic
988598193 5:32614811-32614833 TGGTGGGACAGTTGTAAAATTGG - Intergenic
988878530 5:35474566-35474588 TGGTAAGATAGGTGCACAATGGG - Intergenic
988994164 5:36698314-36698336 AGGATGAAAAGGTGGAAAATGGG - Intergenic
989517664 5:42362254-42362276 AGGATGGAAAGGTGGAAAGTAGG + Intergenic
989745033 5:44819296-44819318 TGGTGGGAACTGTGGCAAATCGG - Intronic
990414995 5:55577914-55577936 TGTTAGGATGGGTGGAAAGTAGG + Intergenic
990853658 5:60237968-60237990 AGGTAGGGAAGGAGGTAAATGGG - Intronic
990936184 5:61152173-61152195 TGGCAGGAAAGGAGGAGGATAGG - Intronic
991480505 5:67073399-67073421 TGCAAGGAAAGTTGGAAAAGTGG + Intronic
991659846 5:68939557-68939579 AGTAAGGGAAGGTGGAAAATAGG - Intergenic
991696983 5:69282259-69282281 TTGTAGAAAATGTAGAAAATAGG + Exonic
993089122 5:83401730-83401752 GGTTAGGAAATGTGGAAAAAAGG + Intergenic
993185085 5:84607185-84607207 GGGAAGAAAAGGTGGAACATAGG + Intergenic
994714310 5:103303524-103303546 TGGGAGGGTAGGTAGAAAATGGG + Intergenic
994935519 5:106248227-106248249 TAGTAGGAAAAGTGGTCAATAGG + Intergenic
995468262 5:112473412-112473434 GGGCAGGCAAGGTGGAAATTGGG + Intergenic
995908186 5:117152278-117152300 TGGTAGAAAAAGTGGAACACTGG - Intergenic
996853206 5:127976128-127976150 TGGAAGGAAAGGTAGAACAGTGG + Intergenic
997368135 5:133338873-133338895 TGGTAGGAGTGGTGGGAAACTGG - Intronic
997774939 5:136594956-136594978 AGGCAGGAAAGGAGGAAAAAGGG - Intergenic
997777633 5:136625405-136625427 TTGCAGGTAAGGTGAAAAATAGG - Intergenic
997811458 5:136974474-136974496 TGATAGGTAAGGTGTAAAGTTGG + Intergenic
998526605 5:142848435-142848457 AGGGAGTAAAGGAGGAAAATGGG - Intronic
998727042 5:145029362-145029384 TGGAAAGAAAAGTGCAAAATGGG - Intergenic
1000257503 5:159554203-159554225 TGGTAGGACAGGTGTGAATTTGG - Intergenic
1002887462 6:1310193-1310215 GGGTAAGAAAGGGGGAAAGTGGG + Intergenic
1004445892 6:15697926-15697948 TTGTAGAAAATTTGGAAAATAGG - Intergenic
1004655612 6:17656864-17656886 TGGAATGAAATGTGGAAATTTGG + Intronic
1006168730 6:32081112-32081134 TGTTTGGAATGGGGGAAAATAGG + Intronic
1006181851 6:32158331-32158353 TGGTAGGAAATGTGATAAAATGG - Intronic
1006208177 6:32368952-32368974 TGATGGGAGATGTGGAAAATGGG - Intronic
1007291388 6:40789770-40789792 TGGTAGTAAAGTAGGAAAAGTGG - Intergenic
1008358067 6:50579039-50579061 GGGAAGGAAAGGTGAAAAACTGG + Intergenic
1009441043 6:63678478-63678500 TAGCAGGAAATTTGGAAAATAGG + Intronic
1009518431 6:64650604-64650626 TTTGAGGAAAGGGGGAAAATTGG + Intronic
1009527882 6:64769738-64769760 AGGTAGGAAAGATGGAAAGAAGG + Intronic
1011708537 6:90027638-90027660 TGGAAGGAGAAATGGAAAATAGG - Intronic
1011729055 6:90241627-90241649 TGCTAGGGTAGGTGGAAAAGAGG + Intronic
1011771792 6:90681487-90681509 TGGAAGGATGGGTGGAAGATGGG - Intergenic
1011996992 6:93603135-93603157 TGGTGGCAAAGGAAGAAAATTGG + Intergenic
1012036021 6:94140727-94140749 TGGTAGGAAGGGTACAATATGGG - Intergenic
1012307450 6:97675877-97675899 TCGTAGGAAAGGTGAGATATAGG + Intergenic
1012340287 6:98112983-98113005 TGGTAGGAGATGTTGATAATTGG + Intergenic
1013875376 6:114820118-114820140 TGGTAGGAAGAGTGGAAACAAGG + Intergenic
1013911299 6:115279004-115279026 TGGTAGAAAAGCAGGAAAAGGGG + Intergenic
1013993594 6:116281147-116281169 GGGAAGGAATGGTGGAGAATAGG + Intronic
1014299026 6:119657300-119657322 TGATTGAAAAGGGGGAAAATGGG - Intergenic
1015095549 6:129410661-129410683 TGGATGGATAGGTGGATAATAGG + Intronic
1015267646 6:131304634-131304656 AAATTGGAAAGGTGGAAAATTGG + Intergenic
1015882324 6:137881560-137881582 TGGTAGGAGAGGAGGAACCTTGG - Exonic
1016430859 6:143983777-143983799 TGGGAGGACAGATGGAGAATGGG + Intronic
1016780734 6:147954960-147954982 TGGTATAAAAGGTTAAAAATGGG - Intergenic
1021290393 7:18836188-18836210 TGGGAGGGAAGGGGGAAAATGGG - Intronic
1021511292 7:21435489-21435511 AGCTACTAAAGGTGGAAAATTGG + Intronic
1021683432 7:23157923-23157945 TGGGAAGAAATGAGGAAAATGGG + Intronic
1021808722 7:24381831-24381853 TGGTAGGAAAGGAGGCTCATGGG - Intergenic
1022185316 7:27961616-27961638 TGGCAGGAAAGAAGGAAAAAGGG + Intronic
1022428975 7:30296678-30296700 TGGTAGGAAGAGTGGACAAAAGG - Intronic
1022987869 7:35677192-35677214 TGTAAGAAAAGGAGGAAAATAGG - Intronic
1023095105 7:36652256-36652278 TGGTAGCAAAACTGGAAAACTGG + Intronic
1023794747 7:43782466-43782488 TGTCAGGAAGGGTGGATAATTGG + Intronic
1027532016 7:79346753-79346775 TGTGAGGAAAGGTTGAACATGGG - Intronic
1028523097 7:91753276-91753298 TGGGAGGGTAGGAGGAAAATAGG + Intronic
1028658109 7:93233966-93233988 TGGTGGGAAAGCAGGAAAATTGG + Intronic
1030419559 7:109290792-109290814 TGGTAAGAAATGTAGAAAAAGGG - Intergenic
1031651006 7:124290088-124290110 GGGTAGGAAAGGGGGGAAACGGG - Intergenic
1032763990 7:134973714-134973736 TGCTAGGTAAGGTTGAAAACTGG - Intergenic
1033544194 7:142385330-142385352 TGGGAGGAATGGAAGAAAATTGG - Intergenic
1037575954 8:20203085-20203107 TGGCAGAAAATGTGGCAAATGGG + Intronic
1037963857 8:23118371-23118393 TGGTAGGAATGAGGGAAACTAGG + Intergenic
1037967112 8:23143579-23143601 TTATAGGAAAGGAAGAAAATGGG + Intronic
1038882012 8:31625249-31625271 TGGAAGGAGAAATGGAAAATGGG + Intergenic
1039216287 8:35275243-35275265 TAGTAGGAAAGATAGGAAATAGG - Intronic
1039344189 8:36686088-36686110 TGCTAGGAAAGGTGGCACACTGG - Intergenic
1041279956 8:56199173-56199195 TGGGGGGACAGGTGGAAAAAAGG + Intronic
1041280660 8:56209228-56209250 TGGAAGGAATTGTGGAAAAATGG - Intronic
1041545233 8:59034957-59034979 TGGAAGGGAAGGTGGAAAGAGGG + Intronic
1042301938 8:67293156-67293178 TTATAGAAAAGGTGGAAAAGAGG - Intronic
1042487984 8:69367513-69367535 TGGTGGGAAGGGAGGAAAGTAGG - Intergenic
1043238379 8:77899211-77899233 TGGTAGGAATGGTGGTCACTAGG + Intergenic
1043538070 8:81227891-81227913 GTGTAGCACAGGTGGAAAATCGG + Intergenic
1043614161 8:82104697-82104719 TGGAAAGAAAGATGGAAAATAGG + Intergenic
1045311354 8:101006019-101006041 TGGAAGCAAAGGTGGAATTTGGG + Intergenic
1046969665 8:120207645-120207667 TGGTATCAAAGGTAGGAAATGGG - Intronic
1047693228 8:127377691-127377713 TGGGAGGACAGGAGTAAAATGGG + Intergenic
1048055198 8:130856207-130856229 TGATAGGAAAGGTGTAAGCTGGG - Intronic
1048536182 8:135297219-135297241 TGGGAGGAAAGCTTGAAAACAGG + Intergenic
1050820706 9:9876066-9876088 TGGAAGGAAGGGAGGAAGATGGG + Intronic
1050863074 9:10461245-10461267 TGGTAAGAATGGGGGAAAAAAGG + Intronic
1051131032 9:13861209-13861231 AGGGGGCAAAGGTGGAAAATAGG + Intergenic
1051339357 9:16096970-16096992 TGGAAGGAAAGGAGGCAAAAGGG + Intergenic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1052318356 9:27139930-27139952 TGGCAGGACAGGGGGAACATAGG - Intronic
1055001260 9:71451304-71451326 TAGTAGGAAGGCTGGAGAATTGG - Intergenic
1055289195 9:74765044-74765066 TGGTAGCAAGGATGGAACATAGG + Intronic
1056487608 9:87074896-87074918 TGTTAGGAAATTTGGCAAATTGG + Intergenic
1056590615 9:87963546-87963568 TGGTAGGACTGGAGGAAACTGGG - Intergenic
1056667085 9:88589617-88589639 TGGTAAGCAAGGTTGAAAATGGG + Intergenic
1056813799 9:89785377-89785399 TGGGAGGGAAGTTGGAATATGGG + Intergenic
1056869398 9:90263515-90263537 TGGGAGGAGAGGTGGCACATAGG - Intergenic
1057326860 9:94073069-94073091 TGGAAGGCATTGTGGAAAATTGG + Intronic
1057397020 9:94689508-94689530 GGGTGGGCAAGGTGGACAATTGG - Intergenic
1057598044 9:96433389-96433411 AGGAAGAAAAGGTGGAAAATGGG + Intergenic
1057941898 9:99292298-99292320 TGGAAGGAAAGGAGGAATGTGGG + Intergenic
1058204478 9:102086352-102086374 TGATAGCAAAGATGGCAAATAGG - Intergenic
1058771253 9:108234526-108234548 TGGGAGGAAAGGTGGGAAGGGGG + Intergenic
1058789052 9:108423245-108423267 TGTTTGGGTAGGTGGAAAATGGG + Intergenic
1060255518 9:122026118-122026140 TGATAGGAGAGGAGGAAAAGAGG + Intronic
1060904850 9:127295614-127295636 TGGTAAGAAATGTGGAATGTAGG - Intronic
1061297978 9:129687280-129687302 TGGAAGGAAAGGGGCAAAAGTGG + Intronic
1061372989 9:130208263-130208285 TTGCAGAAAAGTTGGAAAATAGG - Intronic
1062244051 9:135554360-135554382 TGATAGGAAAGGTCCAGAATAGG - Intergenic
1186090682 X:6044716-6044738 TGGTGGGTGATGTGGAAAATAGG + Intronic
1186092111 X:6061112-6061134 TTTTAGCAAAGGGGGAAAATGGG - Intronic
1187650668 X:21401502-21401524 TGAAAGGAAAGGGGAAAAATGGG - Intronic
1189947182 X:46191388-46191410 TGGTAGGCAAGAGGGAGAATAGG - Intergenic
1190488954 X:50961680-50961702 TTGAAGGAAATGTGGAACATTGG - Intergenic
1191112167 X:56812440-56812462 TGGGAGGAGAGATGAAAAATGGG - Intergenic
1192461813 X:71323476-71323498 TGGTAGGAAAAATGGAACAGGGG + Intergenic
1192571323 X:72208406-72208428 TGGAAGAAAAGGTGGTATATTGG - Exonic
1194312639 X:92331933-92331955 GAGAAGGAAAGATGGAAAATAGG - Intronic
1194997478 X:100607057-100607079 TGGCATGACAGATGGAAAATAGG + Intergenic
1195763796 X:108275169-108275191 TGGGAGGAAAGGAAGAAAAATGG + Intronic
1195827449 X:109017697-109017719 TGGTAGGAGACGTTGATAATGGG + Intergenic
1195934824 X:110114929-110114951 TGGTAGTAAAGGGGGTAAAAAGG - Intronic
1196056617 X:111363103-111363125 TGGAAGGTAAGGTGGGAGATAGG - Intronic
1196260025 X:113568088-113568110 TGGTAGGAGATGTTGACAATTGG - Intergenic
1196480728 X:116144261-116144283 TGCTAAGAAAGGTGAAAAAATGG - Intergenic
1196513060 X:116536470-116536492 TGGTAGGAATATAGGAAAATAGG - Intergenic
1196894290 X:120319603-120319625 TGGGAGGAGAGGAGGAAATTTGG + Intergenic
1197488955 X:127091908-127091930 TAGTAGGAGATGTGGAAAACTGG + Intergenic
1198692347 X:139298075-139298097 TGGTCAGAAAGCTGGAAAGTGGG - Intergenic
1199104372 X:143845447-143845469 TGGTAATAAATGTGAAAAATTGG + Intergenic
1199207980 X:145171856-145171878 TGGTAGGAATGGGTGACAATTGG - Intergenic
1199370892 X:147046697-147046719 TGGTAGAGAAGGGGGGAAATGGG - Intergenic
1199620330 X:149695018-149695040 TTATCAGAAAGGTGGAAAATTGG - Intronic
1200620904 Y:5446078-5446100 GAGAAGGAAAGATGGAAAATAGG - Intronic