ID: 1158584118

View in Genome Browser
Species Human (GRCh38)
Location 18:58715267-58715289
Sequence CTAAGATTCTAAAATTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 443}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158584118 Original CRISPR CTAAGATTCTAAAATTTTCC TGG Intronic
902539718 1:17145570-17145592 CTTAGCTTCTTAAATATTCCTGG + Intergenic
904845114 1:33406190-33406212 TTAATATTCTTAGATTTTCCTGG + Intronic
905152598 1:35943460-35943482 CTAAAATTCAAAAATTAGCCAGG - Intronic
905222530 1:36458660-36458682 ATAAGATTCTAAAACTGTCACGG + Intronic
906651308 1:47515027-47515049 CTAAGATTCAACAATTTTTAAGG + Intergenic
906676311 1:47696031-47696053 CTTAGATTCTAAGATCTTACAGG + Intergenic
908247424 1:62238788-62238810 AAAAGATACAAAAATTTTCCAGG - Intronic
909124723 1:71652702-71652724 CCAAAATTCTAAAATTAACCAGG + Intronic
909190818 1:72547786-72547808 CCAAGATTATAACATTTGCCAGG - Intergenic
909277580 1:73708237-73708259 CTTAGTTTCCAAAGTTTTCCTGG - Intergenic
909462476 1:75933391-75933413 CTAAAATACAAAAATTATCCGGG - Intergenic
909539998 1:76780601-76780623 TTAAATTTCTAAATTTTTCCAGG + Intergenic
909718366 1:78737944-78737966 CTAAGAAACTAAAAATTTACTGG + Intergenic
909960169 1:81830666-81830688 CTAAAATACAAAAATTTGCCAGG - Intronic
910787774 1:91019726-91019748 CTAAAAATGTAAAAATTTCCTGG - Intronic
910947440 1:92609653-92609675 TTAAGTATCTAAAATTTCCCGGG - Intronic
912961841 1:114202993-114203015 CTAAAATACAAAAATTTGCCAGG + Intergenic
914515906 1:148373998-148374020 CTAAAATTCAAAAATTAGCCAGG - Intergenic
914951405 1:152118223-152118245 CTAAGAGTATTAGATTTTCCTGG + Intergenic
915021242 1:152780576-152780598 CTAAGAGCCTAAAATATTCTAGG + Intronic
916166151 1:161968947-161968969 CTAAAATACTAAAATTAGCCAGG + Intergenic
916307897 1:163360222-163360244 CAAAGTGTGTAAAATTTTCCTGG + Intergenic
916936902 1:169638300-169638322 CTAAAAATACAAAATTTTCCAGG + Intergenic
917076005 1:171205765-171205787 CTAACATTCTAAAAAGTTACTGG + Intronic
917434302 1:175003277-175003299 TTAAAATTCAAAAATTTGCCGGG - Intronic
917651567 1:177082843-177082865 CTAGGATCATAAAATTTTCATGG + Intronic
918108979 1:181439294-181439316 CTAACCTTCTAAAATTTACAGGG - Intronic
918490762 1:185078881-185078903 CTAAAATACAAAAATTTGCCAGG + Intronic
918794929 1:188882163-188882185 CTTACATTATGAAATTTTCCTGG + Intergenic
919039528 1:192365229-192365251 CTAAGATCCTCACATATTCCAGG - Intronic
919357618 1:196545206-196545228 CCAACATTTTAAAATTGTCCAGG + Intronic
922037314 1:221861845-221861867 CTGAGATTGTAACCTTTTCCAGG + Intergenic
922235867 1:223722059-223722081 CTTAGATTATGAAATTTTCAAGG - Intronic
923170055 1:231407424-231407446 TTAAGCTTCTAAAATTATCATGG - Intronic
923402487 1:233628597-233628619 CTAAAATTCAAAAATTAGCCAGG + Intronic
924502189 1:244648119-244648141 CGAAGTTTTTAAAACTTTCCAGG + Intergenic
924610125 1:245566764-245566786 CTAAAATACAAAAATTATCCAGG + Intronic
1062992438 10:1832963-1832985 CTAAAATACAAAAATTATCCAGG + Intergenic
1063280609 10:4625478-4625500 TTAAGATTTTAAGTTTTTCCTGG - Intergenic
1063282703 10:4648176-4648198 CTAAGAATCAAAAATTAGCCAGG + Intergenic
1063868318 10:10390932-10390954 AGAAGATTCTAAAATATTCAAGG - Intergenic
1064121018 10:12619446-12619468 CAAAAATTCTAAAATTAGCCAGG - Intronic
1064444541 10:15381873-15381895 CTAAGTTTTTAAATTTTTCATGG - Intergenic
1067127937 10:43536059-43536081 CTAAGATTATAAAATTAGCTGGG + Intergenic
1068895801 10:62199651-62199673 TTAAAATGCTAAAATTTTCAGGG - Intronic
1070408794 10:76120347-76120369 CTAAAATACAAAAATTATCCCGG - Intronic
1071541470 10:86488419-86488441 CTGACATTCTAAGATGTTCCAGG - Intronic
1071782962 10:88867070-88867092 CTAAGATTCTAGAAACTTGCAGG - Intergenic
1071879876 10:89885573-89885595 CAAAGGTTCTAGGATTTTCCTGG + Intergenic
1071966072 10:90854190-90854212 CTAAAATTCAAAAATTAGCCGGG + Intronic
1073592850 10:104772753-104772775 CTCAGATTCTCACCTTTTCCTGG + Intronic
1073616642 10:105003172-105003194 CTAAGATTGTAATATCTGCCTGG + Intronic
1075731943 10:124641615-124641637 ATAAGATTCTAAAATCCTCGAGG + Intronic
1077083095 11:734306-734328 CTAAAATACAAAAATTATCCAGG + Intergenic
1078065642 11:8077532-8077554 CTGAGATTCTACAATTGACCGGG - Intronic
1078074786 11:8148651-8148673 ATAGGATCCTAAAATTTTCCTGG - Intronic
1078954215 11:16171758-16171780 CTAAAATTCTAATATCTTTCAGG - Intronic
1079630550 11:22668592-22668614 CCAAGATGCTAAAAAATTCCAGG - Intronic
1080922301 11:36721290-36721312 CTGACATTCTAACATGTTCCAGG + Intergenic
1081258716 11:40931073-40931095 CTGAGATTCTAAAACTCTTCTGG - Intronic
1082128852 11:48462873-48462895 ATAAGATAATAAAATTTTACTGG + Intergenic
1082184809 11:49165818-49165840 TTTAGATTCTAAAATTTATCTGG + Intronic
1082562398 11:54633848-54633870 ATAAGATAATAAAATTTTACTGG + Intergenic
1082776246 11:57246619-57246641 CAAAAATACAAAAATTTTCCAGG - Intergenic
1083452467 11:62754921-62754943 CAAAAATTCTAAGATTTGCCGGG + Intergenic
1084103134 11:66963294-66963316 CTAACACTCTAAAATGTTCTTGG + Intergenic
1085006235 11:73093335-73093357 CTTAGATTCAATAATTTGCCAGG - Intronic
1085579164 11:77635510-77635532 CTAAAATACAAAAATTATCCGGG - Intronic
1086577136 11:88351402-88351424 CTGTGATTCTAAAATTTACAGGG - Intergenic
1086681532 11:89679541-89679563 TTTAGATTCTAAAATTTATCTGG - Intergenic
1086748911 11:90465662-90465684 CTAAAATACAAAAATTTTCTGGG + Intergenic
1087111943 11:94480042-94480064 CTAAGTTTTTAAAATTTTGAAGG - Intronic
1087408244 11:97756327-97756349 CTAATATTTTAAATTTGTCCAGG + Intergenic
1088444118 11:109904420-109904442 CTACGATTGTTACATTTTCCTGG - Intergenic
1088924885 11:114291720-114291742 CTAAGTTTCTAAGTTTCTCCTGG + Intronic
1089415794 11:118289288-118289310 TTAAGATTCTAAAATTTATATGG + Intergenic
1089841403 11:121421312-121421334 CTTAGTTTCTAAAACTTACCTGG + Intergenic
1090815290 11:130288734-130288756 CTAAAATACAAAAATTATCCAGG + Intronic
1092442553 12:8519784-8519806 CTCAGATTCTAACTTTTTCTTGG + Intronic
1092514854 12:9199770-9199792 TTAAAATTGTAAAATTTGCCAGG - Intronic
1092965080 12:13633545-13633567 CAAAGATTTTAATATTTACCAGG + Intronic
1093639693 12:21511733-21511755 CAAAGAAACTAAACTTTTCCTGG - Intronic
1096700012 12:53376384-53376406 CTAAGATACAAAAATTAGCCAGG + Intergenic
1098860175 12:75700487-75700509 CTAAGATTATTAAATTTTCTGGG + Intergenic
1099019259 12:77382727-77382749 CAATGATTCTAAAATTCTCAAGG + Intergenic
1099287566 12:80733427-80733449 CTAAGATTACAAAATTAGCCGGG + Intergenic
1099344780 12:81484487-81484509 ATAATATTCAAAATTTTTCCAGG + Intronic
1099475155 12:83099503-83099525 CTTAGAGTTTAAATTTTTCCAGG + Intronic
1099496594 12:83354443-83354465 CTAATATTCTAAGATTTGCATGG + Intergenic
1099681010 12:85827486-85827508 ATAAGATTCTATAATTCCCCTGG + Intronic
1100009493 12:89936479-89936501 CAATGATTCTAAAATATTCTAGG - Intergenic
1102109469 12:110353725-110353747 CAAAAATTATAAAATTTGCCAGG - Intergenic
1102409153 12:112702203-112702225 CTTAGGTTTTAAAATATTCCAGG + Intronic
1103410115 12:120705434-120705456 CTAAGAATATAAAATTAGCCAGG + Intergenic
1103665926 12:122565721-122565743 ATAAAATACTAAAATTTGCCAGG + Intronic
1104314522 12:127684647-127684669 CAAAGGCTCTAAATTTTTCCAGG + Intergenic
1106502669 13:30344273-30344295 CTAAAATTATAAAATTAGCCAGG + Intergenic
1106684005 13:32037631-32037653 CTCAGATTGTAAAATTATCCGGG - Intronic
1107279084 13:38712761-38712783 GTAAGTTAATAAAATTTTCCTGG + Intronic
1108926823 13:55759831-55759853 GTAACATTCTTAAATTTTACTGG - Intergenic
1109379010 13:61534198-61534220 TCAAGATTCTAAACATTTCCAGG + Intergenic
1109618974 13:64876079-64876101 CAAAAATTTTAAAATTTTCATGG + Intergenic
1109700269 13:66015682-66015704 CTAATATTATAAACATTTCCTGG - Intergenic
1109739953 13:66540168-66540190 TTAATATTCTAAACTTTGCCAGG - Intronic
1109975841 13:69830386-69830408 TTAAGATTGTGATATTTTCCTGG - Intronic
1110014963 13:70388407-70388429 CTGAGCTTCTAAATTTTTGCAGG + Intergenic
1110339165 13:74368952-74368974 CCAAGGTTCTAAAATTTTGGGGG - Intergenic
1110807059 13:79767882-79767904 CTAAGATTCTTAAATTTAAGAGG + Intergenic
1111223251 13:85234242-85234264 CTAATATTATAATACTTTCCTGG + Intergenic
1111371881 13:87329875-87329897 ATTAGATTCTAAAATATTCATGG - Intergenic
1111670895 13:91328756-91328778 CTAAGATTCTAATATTTTTCTGG - Intergenic
1112293918 13:98169727-98169749 TTAAGATTCTAAAATGTTCCAGG - Intronic
1112658642 13:101481367-101481389 ATAATATTCTAAAATTTTGTGGG + Intronic
1112870936 13:103969739-103969761 GTAAAATTCTAAAATCTTCCTGG - Intergenic
1114413586 14:22523454-22523476 CTTTGGTTCTCAAATTTTCCAGG + Intergenic
1114430657 14:22657616-22657638 CTAAGAATTTAATATTTTCTGGG + Intergenic
1117145292 14:52831178-52831200 CCTAGATTCCAAAATTTTCCTGG + Intergenic
1118601680 14:67475074-67475096 CTAAAATTCAAAAATTAGCCGGG - Intronic
1119251000 14:73153872-73153894 CTAAAATACTAAAATTAGCCAGG - Intronic
1119412500 14:74442348-74442370 CTGATGTTCTAAAGTTTTCCTGG + Intergenic
1119747004 14:77051812-77051834 CTAAAATTATAAAATTAGCCGGG - Intergenic
1121856776 14:97277595-97277617 TTAAGATTCTAAAATTTGCATGG - Intergenic
1121937534 14:98034007-98034029 CTAAAAATATAAAATTATCCAGG + Intergenic
1124002676 15:25771911-25771933 CTAAAATACAAAAATTATCCAGG - Intronic
1124050828 15:26196228-26196250 CTAAAATACAAAAATTTGCCAGG + Intergenic
1124073498 15:26419318-26419340 CTAAAATTAAAAACTTTTCCAGG + Intergenic
1125066304 15:35489385-35489407 TTAAGATTCAAAAAGTTTCAAGG - Intronic
1125175089 15:36811755-36811777 CTAAGATAATAAGATTTTACAGG + Intergenic
1126158872 15:45590567-45590589 CTAAAAATATAAAAATTTCCCGG - Intronic
1126635718 15:50777883-50777905 CTAAAATACAAAAATTATCCAGG - Intergenic
1127338502 15:58015059-58015081 ATAAGAATTTAAAATTTTTCTGG - Intronic
1128124633 15:65183647-65183669 CTATGATTCAAAAATGTTCACGG + Intronic
1129498422 15:76010687-76010709 ACAAGATTATAAAATTTTTCAGG + Intronic
1130729135 15:86472489-86472511 CTAACATTATACAATTTTACAGG + Intronic
1131370632 15:91878244-91878266 CTAAAATACAAAAATTATCCAGG - Intronic
1133068671 16:3230316-3230338 TTAAGAGTTTTAAATTTTCCAGG + Intronic
1134003540 16:10801615-10801637 CTAAAATACAAAAATTATCCAGG - Intronic
1134010398 16:10847852-10847874 CAAAAATGCAAAAATTTTCCAGG + Intergenic
1135349887 16:21719815-21719837 CTAATATTCCAACACTTTCCAGG + Intronic
1136521055 16:30796070-30796092 CTAAAATTCAAAAATTAGCCAGG + Intergenic
1136553045 16:30991705-30991727 CTAAAATTCTAAAATTAGCCAGG + Exonic
1139907810 16:70378832-70378854 CTAAAAATATAAAATTATCCGGG + Exonic
1140816412 16:78625122-78625144 CTAAGCTACTAAAACTTTGCTGG + Intronic
1140918070 16:79511459-79511481 TTAAGATGATAAAACTTTCCTGG - Intergenic
1143533298 17:7519123-7519145 TTAAAATTCTAATACTTTCCTGG + Intergenic
1143534576 17:7529435-7529457 CTAAAATACAAAAATTATCCGGG - Intergenic
1144412478 17:15014465-15014487 CTAAAATTCAAAAATTAGCCAGG + Intergenic
1145949231 17:28803167-28803189 CTAAAATTCAAAAATTAGCCAGG - Intronic
1147194714 17:38758252-38758274 CTAAGAATCCAGAATTTTTCAGG + Intronic
1147490476 17:40861362-40861384 CTATGATTAAAAAATATTCCGGG + Exonic
1147752749 17:42746343-42746365 CTAAAATTACAAAATTTGCCGGG - Intergenic
1148050187 17:44766288-44766310 TTAGGATTCTCAAATTCTCCAGG - Intronic
1149717824 17:58811016-58811038 CAAAAATACAAAAATTTTCCAGG - Intronic
1149729158 17:58927495-58927517 CTAAGATTCCACAATTTTTTTGG - Intronic
1149872764 17:60197928-60197950 CTGAGATTATACAAATTTCCTGG + Intronic
1150051615 17:61969760-61969782 CAAAAATTCAAAAATTATCCCGG - Intronic
1151013045 17:70523821-70523843 ATAAAACTCTCAAATTTTCCTGG - Intergenic
1151396226 17:73824888-73824910 CTAAAATACAAAAATTATCCAGG - Intergenic
1151981482 17:77512558-77512580 CTCAGATTCTACAGTTTTCAAGG - Intergenic
1153861113 18:9208022-9208044 CAAAGATCCAAAAATTTTCAAGG - Intronic
1154091075 18:11363986-11364008 CTAAAATTATAAAAATTACCTGG - Intergenic
1155542546 18:26883659-26883681 AAAAAATTCTAAAATTTTCACGG + Intergenic
1155891038 18:31269488-31269510 CAAAGTATCTAAAATTTTCCAGG - Intergenic
1156526032 18:37768188-37768210 CTAAGAATATAAAAATTACCTGG + Intergenic
1156740483 18:40321308-40321330 CCAACATTCTAAATTTTACCTGG - Intergenic
1156813304 18:41278092-41278114 CTAAAATACAAAAATTATCCAGG + Intergenic
1156939609 18:42750831-42750853 CTATGATTCAAAAGTTTTCAGGG - Intronic
1156996348 18:43472432-43472454 CTTAGTTTATAAAAGTTTCCTGG + Intergenic
1158090335 18:53704176-53704198 CTAAGATTCTAGCATTTTGGGGG - Intergenic
1158584118 18:58715267-58715289 CTAAGATTCTAAAATTTTCCTGG + Intronic
1158861032 18:61592606-61592628 CACAGAATCTAAAATATTCCTGG - Intergenic
1159380742 18:67655098-67655120 GTAAGAATCTGAGATTTTCCTGG + Intergenic
1159565384 18:70042305-70042327 TAAAGATTCTAAAAACTTCCAGG + Intronic
1159976099 18:74713340-74713362 AAAAGATGCTAAAATGTTCCAGG - Intronic
1161339753 19:3734791-3734813 CTAAGATACCAAAATTAGCCCGG + Intronic
1161955538 19:7492601-7492623 CTAAAAGTCTAAAATTAGCCGGG - Intronic
1162044579 19:7990181-7990203 CTAAAATTCAAAAATTAGCCAGG - Intronic
1162883231 19:13676248-13676270 CTAAGATTGCAAAAATTACCCGG + Intergenic
1162952075 19:14077255-14077277 CAGCGATTCTAAAATGTTCCTGG - Intergenic
1163735998 19:18981202-18981224 CTAAAATACAAAAATTATCCAGG - Intergenic
1165010446 19:32842511-32842533 CAAAGATTCAGAAATTTCCCAGG - Intronic
1165320045 19:35079657-35079679 CAAAAATTTTAAAATTTGCCAGG + Intergenic
1165536008 19:36445656-36445678 CTAAAAATACAAAATTTTCCAGG + Intronic
1166173830 19:41051324-41051346 CTAAAATTCAAAAATTAGCCAGG - Intergenic
1166706786 19:44912556-44912578 CAAAAATTCAAAAATTATCCAGG - Intergenic
1167170995 19:47831901-47831923 CTAAAATACAAAAATTATCCGGG - Intronic
1167462100 19:49630859-49630881 CAACGATTCTAAAGCTTTCCAGG - Intergenic
925439875 2:3876270-3876292 CTAAGATTCTAAATATCTCTGGG + Intergenic
925564973 2:5241461-5241483 CTATGATTCAAAACTTTGCCAGG - Intergenic
925699218 2:6616399-6616421 CTAAGCATCTATAATATTCCAGG - Intergenic
926020819 2:9494302-9494324 CTAAGATTGCAAAATTATTCAGG - Intronic
927655454 2:24941609-24941631 CTAAAATTACAAAAATTTCCTGG - Intergenic
927781605 2:25943702-25943724 CTAAAATTACAAAATTTGCCAGG + Intronic
928046065 2:27933627-27933649 CTAAAATACAAAAATTATCCGGG - Intronic
928966608 2:36982102-36982124 GTAAGATTATAAAATTTTTACGG + Intronic
930976463 2:57467977-57467999 AAAAGATTCTAAAATTTTTGTGG - Intergenic
933377828 2:81502573-81502595 CTAATATTCTAAAATGTAGCTGG - Intergenic
933408634 2:81896170-81896192 TTACGATTAAAAAATTTTCCAGG + Intergenic
933546745 2:83723144-83723166 CCCAGATTCTACAATTTTCAGGG + Intergenic
934081354 2:88471001-88471023 CTAAAATACAAAAATTATCCAGG - Intergenic
934541686 2:95180669-95180691 CTAAAATACAAAAATTATCCAGG - Intronic
935113826 2:100116601-100116623 CTAAGGTCCTTGAATTTTCCTGG - Intronic
936400186 2:112158873-112158895 CTAAAATTCTCAAGGTTTCCTGG - Intronic
937545480 2:123012442-123012464 ACTAGATTTTAAAATTTTCCAGG - Intergenic
937671149 2:124538315-124538337 CTAAAATACAAAAATTATCCAGG + Intronic
938573128 2:132580798-132580820 CTAAAATTATAAAAATTTGCCGG + Intronic
940526023 2:154814844-154814866 CAAAGATTACAAAATGTTCCTGG - Intronic
941352688 2:164455780-164455802 CTCAAATTCTAAAATCTACCAGG + Intergenic
942012856 2:171780608-171780630 CTAAAATACTAAACTTTTCAAGG + Intergenic
942117944 2:172747624-172747646 CTAAAAATAAAAAATTTTCCAGG - Intronic
942291026 2:174471090-174471112 ATAAGATTCTAAAATCCTGCCGG + Intronic
943114279 2:183646836-183646858 CTAAGTTTCTAAGATTTTCTTGG - Intergenic
944582402 2:201143309-201143331 CTAAAAATACAAAATTTTCCAGG + Intronic
944603841 2:201331443-201331465 CTTGGGTTCTAAAATTATCCTGG - Intronic
944949239 2:204728120-204728142 CTCAGTTTTTAAAATTTGCCTGG + Intronic
945008399 2:205434888-205434910 TTAAGTTTTTAAAATTTTCTTGG + Intronic
946018842 2:216625656-216625678 TTAAAATTAAAAAATTTTCCAGG - Intergenic
946560927 2:220912709-220912731 TTCAGATTCTGAAATTTTCAAGG + Intergenic
946775065 2:223129202-223129224 CTAAGATTCTGAAATCTAGCTGG - Intronic
947179614 2:227400598-227400620 CTAAAATACAAAAATTATCCGGG - Intergenic
947651355 2:231788766-231788788 CTAAGACTCTGTAATTCTCCAGG + Intronic
948439023 2:237974349-237974371 CTAAGAATATAAAATTAGCCAGG - Intronic
948819546 2:240533081-240533103 CTAAGTTTCATACATTTTCCTGG + Intronic
948904781 2:240973622-240973644 CACAGGTTCTAAAAGTTTCCGGG + Intronic
1169046159 20:2536170-2536192 CAAACATTCTAGAATTTCCCTGG + Intergenic
1169582049 20:7034570-7034592 CTAAAAATCTAAAATTAGCCAGG - Intergenic
1169812395 20:9621441-9621463 CTAAGAGTGAAAAATTTTTCAGG - Intronic
1169954885 20:11090478-11090500 CTAAATTTCTAAAAACTTCCTGG - Intergenic
1172130368 20:32650900-32650922 CTAAGATTCTATGATCTTCTTGG - Intergenic
1172546700 20:35767540-35767562 CTAAAATACAAAAATTTGCCAGG - Intergenic
1172730181 20:37080618-37080640 CTAAAATTATAAAAATTTGCTGG - Intronic
1173650981 20:44664013-44664035 CTAAGATTCTACTATGTACCAGG + Intergenic
1173753837 20:45497730-45497752 CTAAAATACAAAAATTTGCCAGG - Intergenic
1173806102 20:45926242-45926264 CTAAAAATCTAAAAATTACCTGG + Intergenic
1174103461 20:48145099-48145121 GTAAGATACTAACATTTACCTGG - Intergenic
1174282186 20:49447276-49447298 CTAAGAGTCTCGAATCTTCCAGG - Intronic
1181652414 22:24267372-24267394 CTAAGAATATAAAATTAGCCTGG + Intergenic
1181944517 22:26505616-26505638 CTAAAATTCTAGATTTTGCCTGG - Intronic
1182660597 22:31922359-31922381 CTAAAATACAAAAATTATCCAGG - Intergenic
1182970019 22:34564941-34564963 CTAAAATACAAAAATTATCCAGG + Intergenic
949392287 3:3576237-3576259 CTACGATTCTAAAATTCACTTGG + Intergenic
949418987 3:3845280-3845302 CTAAGCTTCTCAAATTTGCGAGG - Exonic
950288918 3:11767784-11767806 CTAAAATTCAAAAATTAGCCAGG - Intergenic
950717115 3:14856369-14856391 TTAAAATTCTAAAATTTACATGG - Intronic
950747842 3:15104863-15104885 CTAAGATACAAAAATTAGCCAGG + Intergenic
950806304 3:15605880-15605902 CTAAAATACAAAAATTATCCAGG + Intronic
951423883 3:22519440-22519462 CAAAAATACAAAAATTTTCCAGG - Intergenic
953633799 3:44644475-44644497 CTAAAATACAAAAATTATCCGGG + Exonic
954404878 3:50340137-50340159 CAAAGGTTCTAAATTTTTCCAGG + Intronic
955862986 3:63352243-63352265 TTAAAATTCTAAAATTGTACAGG - Intronic
957631699 3:82723938-82723960 ATATGATTTTAAAATATTCCTGG + Intergenic
957740261 3:84257180-84257202 TTAAGTTTCAAAAATTTTCAAGG - Intergenic
958179499 3:90041198-90041220 CAAAGATTCTAATTTTTTACGGG + Intergenic
958977076 3:100680701-100680723 ATAAGATTCTAAGATTTTACTGG - Intronic
959225537 3:103578758-103578780 CAAAGCTACTGAAATTTTCCTGG - Intergenic
960105979 3:113797415-113797437 CTAAAATACAAAAATTATCCGGG - Intronic
960269098 3:115655049-115655071 CTTTGATTATAAAGTTTTCCAGG + Intronic
960855975 3:122102588-122102610 CTATGGTTGTAAAATTGTCCAGG + Intronic
963416887 3:145008114-145008136 ATAAGATGCTAAAATTTACATGG - Intergenic
964635236 3:158851109-158851131 CTCATATACTCAAATTTTCCTGG + Intergenic
964713773 3:159699653-159699675 CTAAGAAGCTAAGATTCTCCAGG - Intronic
965598409 3:170430839-170430861 CTAAGAAGCTAAAATTGGCCAGG - Intronic
966362217 3:179142544-179142566 CTAAGATTTTAAAAATATCTGGG + Intergenic
966557074 3:181274583-181274605 CGCAGTTTCCAAAATTTTCCGGG + Intergenic
966797211 3:183726960-183726982 CTAAGAATACAAAATTATCCAGG - Intronic
967346916 3:188467597-188467619 CTAAGATAATGAAATTATCCTGG + Intronic
967649260 3:191965490-191965512 CTAAGAATATAAAATTAGCCAGG + Intergenic
967769615 3:193320277-193320299 CTGTAATTCTAAAATATTCCTGG + Intronic
968028636 3:195464218-195464240 CTAAAAATCTAAAATTAGCCAGG - Intergenic
968499224 4:938879-938901 CATAGATTCTAAAATTTACTTGG + Intronic
968818895 4:2835608-2835630 CTAAAATAATAAAATTTTACAGG - Exonic
970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG + Intergenic
970069014 4:12134654-12134676 CTGAGATTCTAAGATTTTGATGG - Intergenic
970083635 4:12320154-12320176 CCAGGATTCTATAATTTACCAGG - Intergenic
970322788 4:14891909-14891931 TTCAGATTCTAACATTTTGCTGG - Intergenic
970491459 4:16579314-16579336 TTAAAATTTTAAAATTTTCAGGG - Intronic
970930320 4:21503981-21504003 CTAAGCTTCTCAAATCTTCTAGG + Intronic
972089662 4:35265328-35265350 GAAAGTTTCTAAAATTTACCAGG + Intergenic
973187600 4:47349051-47349073 CTCAGAATCTAAAACATTCCCGG - Intronic
974324576 4:60397164-60397186 TTAATATTTTAAGATTTTCCTGG + Intergenic
974462213 4:62202927-62202949 CAAAGACTATAAAATTCTCCAGG - Intergenic
974868819 4:67613145-67613167 TTCAGATACTGAAATTTTCCAGG - Exonic
975072915 4:70164888-70164910 TTAAAATTCCAAAATTTTCTTGG - Exonic
975176225 4:71292597-71292619 CTGGGATTCTGAAATTTTTCTGG + Intronic
975473112 4:74793490-74793512 CTAAGATTAGAAAATGTTACTGG + Intronic
976725230 4:88209500-88209522 CTAAAATACAAAAATTATCCAGG + Intronic
976950058 4:90817540-90817562 CTTAGTTTCTAAAATTTCTCAGG + Intronic
978434025 4:108663967-108663989 ATAAGATTATGAAATTTTCTGGG + Intronic
978718749 4:111878797-111878819 CCAAAATTTTAAAATTTTCTTGG - Intergenic
979118763 4:116865572-116865594 CAAATATCCAAAAATTTTCCAGG - Intergenic
979578731 4:122329387-122329409 ACAAGATTCTAAAAATGTCCAGG - Intronic
979785876 4:124713600-124713622 CTTAGATTCCAAATTTCTCCCGG + Intergenic
979944098 4:126804255-126804277 CTAAGATCCTCACATTTTCCTGG - Intergenic
980310020 4:131115141-131115163 ATAAGATTTTTCAATTTTCCTGG - Intergenic
980583111 4:134779698-134779720 TTAAGATTCTAGTATTTTCAGGG - Intergenic
980745983 4:137016511-137016533 CAAAGATTCTAAAATTCATCAGG - Intergenic
982557281 4:156883390-156883412 CTAAGAGTCTAAAAATCACCTGG - Intronic
982564997 4:156974819-156974841 CTAAAATACTGAAATGTTCCAGG - Intergenic
982805863 4:159761513-159761535 CTTAGATTCCAAAATTTACTAGG + Intergenic
983190028 4:164745454-164745476 CTAAAATACAAAAATTATCCAGG - Intergenic
983372931 4:166886153-166886175 CTATGAATCTCACATTTTCCTGG + Intronic
983445300 4:167843053-167843075 CTAAAAATATAAAATTTGCCCGG + Intergenic
983816812 4:172139679-172139701 CTAAAATTTTCAAATTTGCCTGG - Intronic
984043477 4:174767888-174767910 CTAAGAACATAGAATTTTCCAGG + Intronic
984510282 4:180670754-180670776 TTAAGATTCTAAAATTTTTAGGG + Intergenic
985021702 4:185698313-185698335 CTAAAATTCAAAAATTAGCCGGG + Intronic
985079611 4:186251491-186251513 CTGCCATTCTAAAATTTACCCGG + Exonic
985150047 4:186937627-186937649 CTAAAAATATAAAATTATCCGGG + Intergenic
986065990 5:4234638-4234660 AGAAGATTCTAAAATATTCCAGG + Intergenic
987170384 5:15250588-15250610 CTAAAATAGTAAAATTTTCATGG - Intergenic
987377923 5:17254124-17254146 TCAAGATGCTAAAGTTTTCCTGG - Intronic
988610493 5:32719556-32719578 AGAACATTCTAAAAATTTCCAGG - Intronic
989174699 5:38512319-38512341 CTAAAAATCTAAAATCTGCCTGG + Intronic
990476459 5:56165766-56165788 CTAAAAATACAAAATTTTCCGGG + Intronic
991492060 5:67193412-67193434 CTGAGATTCTGGAACTTTCCAGG - Intronic
993072080 5:83177824-83177846 TTAAGATTCTAAAGCCTTCCTGG - Intronic
993355382 5:86900263-86900285 ATAGGTTTCTAGAATTTTCCTGG + Intergenic
993374708 5:87136729-87136751 CTAAGAGCCTATAATTTTCTGGG + Intergenic
995202386 5:109441066-109441088 CTAATATTCTAAAACTTTTTTGG + Intergenic
995622418 5:114040460-114040482 TTAAGATAAAAAAATTTTCCAGG - Intergenic
998905436 5:146899901-146899923 AGAAGATCCTAAAAGTTTCCTGG + Intronic
999029147 5:148270732-148270754 CTAAGATTGAAAAATTATACTGG + Intronic
999238633 5:150114749-150114771 CTAACATTCTAGAGTATTCCAGG - Exonic
1000058237 5:157628548-157628570 TAAAGTTTCTAAAATTTTTCAGG + Intronic
1000184835 5:158849121-158849143 CTAAGAGTCAAAAGTTTTCCTGG - Intronic
1000192291 5:158923173-158923195 CTAAAGCTCTAAAATTCTCCAGG + Intronic
1000287563 5:159839926-159839948 GTTAGAGTCTATAATTTTCCAGG - Intergenic
1001152131 5:169240960-169240982 CTAAGATCCTTAAATTATTCAGG - Intronic
1001677898 5:173533763-173533785 CTAAGAATCAATCATTTTCCCGG + Intergenic
1002378300 5:178804944-178804966 CTCACATTGTAAAATTTTCCTGG - Intergenic
1003451745 6:6240843-6240865 CTATGATTCTAAAATGACCCAGG - Intronic
1004296344 6:14415393-14415415 CAAAACTTCTTAAATTTTCCTGG + Intergenic
1004554767 6:16684792-16684814 ATAAGATCCTAAAATTTTATAGG - Intronic
1004783492 6:18939247-18939269 GAAAGACTCTAAAATTTTCTAGG + Intergenic
1005359404 6:25016821-25016843 CTGGGTTTCTAAAAATTTCCAGG + Intronic
1006322840 6:33330578-33330600 CTAAAATACAAAAATTATCCGGG + Intergenic
1007066381 6:38994803-38994825 CTAAAATACAAAAATTTGCCAGG - Intronic
1007953866 6:45898280-45898302 CTAAAATACAAAAATTATCCAGG + Intergenic
1008677847 6:53840399-53840421 ATTAGATTCTAAAAGTTTCCAGG - Intronic
1008847036 6:55979466-55979488 CTAATCTTTTAAAATTTTCATGG - Intergenic
1009038436 6:58147159-58147181 TGAAGTTTCCAAAATTTTCCAGG - Intergenic
1009214226 6:60900811-60900833 TAAAGTTTCCAAAATTTTCCAGG - Intergenic
1009321131 6:62289867-62289889 CTATGTTTCCAAAATTGTCCTGG + Intergenic
1010414518 6:75598780-75598802 CTATGATTCTAAATTTTCCTTGG + Intergenic
1011061642 6:83276375-83276397 CTGAGTTTATAAAGTTTTCCTGG - Intronic
1011247713 6:85337065-85337087 GTAAGTTGATAAAATTTTCCTGG + Intergenic
1011737715 6:90328903-90328925 TTGTGATTTTAAAATTTTCCAGG - Intergenic
1011773346 6:90700096-90700118 CTAAGTTTCTAAAATCCTCATGG + Intergenic
1011914866 6:92490736-92490758 CTAATATACAAAAATTATCCGGG - Intergenic
1013647266 6:112157240-112157262 TTAATATTTTAAAATTTTGCTGG + Intronic
1013841669 6:114403344-114403366 CTAAGAGAGTAAAATTGTCCAGG + Intergenic
1014355296 6:120400993-120401015 AAAAAATTCTAAAATTTACCTGG - Intergenic
1014364065 6:120518554-120518576 CTAAAATTTTAAAATTGTACAGG + Intergenic
1014530571 6:122554278-122554300 CAAAGATTCTTGAATTTTCCAGG + Intronic
1014690970 6:124563289-124563311 CTAATGTTCAAAAATTATCCAGG - Intronic
1015159951 6:130142015-130142037 ATAAGATTTTAAAAATTGCCCGG - Intergenic
1015694094 6:135960167-135960189 CTAGGATTCTAGAATTTTGACGG + Intronic
1016013334 6:139160577-139160599 CTAATTTTTTAAAATTTTCATGG + Intronic
1016329003 6:142936351-142936373 CTAAAATTCAAAAATTAGCCTGG - Intronic
1016356826 6:143227480-143227502 CCAAGAATTTAGAATTTTCCAGG - Intronic
1016767766 6:147814403-147814425 CTAAGATTCTATATTTTTTTAGG + Intergenic
1017192742 6:151670927-151670949 CTAAGAATACAAAATTATCCAGG - Intronic
1017414160 6:154202048-154202070 CTCAGAATCTACAAATTTCCTGG - Intronic
1017569143 6:155724297-155724319 TTAAAACTCTAAAACTTTCCAGG - Intergenic
1017588232 6:155949651-155949673 CTAAGTTTTCAAAATTTTCTGGG - Intergenic
1018843876 6:167540576-167540598 CTAAAAATCTAAAATTAGCCGGG + Intergenic
1019018080 6:168894712-168894734 CTGAGATCCTAAAATTTTTGAGG + Intergenic
1020862873 7:13516424-13516446 CTAAGATTCTTATAATCTCCAGG - Intergenic
1020959541 7:14786110-14786132 CAAAGATTAGAAAAATTTCCAGG + Intronic
1021187142 7:17577271-17577293 CTAAGATGGGAAAGTTTTCCTGG - Intergenic
1021193530 7:17649177-17649199 CAAAGATTTTGAAATTTTCCTGG - Intergenic
1021614407 7:22487641-22487663 CTAAAATTATAAAATTAGCCAGG + Intronic
1022975550 7:35552636-35552658 CTAAGAGTCTGAAATGTGCCAGG + Intergenic
1023116918 7:36871837-36871859 CTCAAATGCTAACATTTTCCAGG + Intronic
1023655739 7:42418942-42418964 ATAACATTCTAAAATTTACACGG - Intergenic
1024898056 7:54283036-54283058 CGAAGCTTTTAAAAATTTCCTGG - Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026198129 7:68190548-68190570 CTAAAAATATAAAATTATCCAGG + Intergenic
1027196668 7:76035297-76035319 CTCAGATTTTAAAGATTTCCCGG - Intronic
1027537106 7:79416893-79416915 CTAAAATACAAAAATTTTTCAGG - Intronic
1027777454 7:82484529-82484551 CCAAGAATTTAAAATTTACCTGG - Intergenic
1027967570 7:85032173-85032195 CTTACATTCTCAAATTTTACAGG + Intronic
1027974498 7:85133600-85133622 ATAAAATTCTTGAATTTTCCAGG + Intronic
1028072167 7:86464105-86464127 CAAAAATTATAAAATTATCCAGG - Intergenic
1029602688 7:101578347-101578369 CACAGATTTTAAAATTTTCTGGG - Intergenic
1029621955 7:101695724-101695746 CTAAAATACAAAAATTATCCAGG + Intergenic
1029801173 7:102949040-102949062 TTAATTTTCTAAAATTTTACTGG + Intronic
1030440874 7:109587695-109587717 CTAAAATACAAAAATTTGCCAGG - Intergenic
1031144864 7:117986456-117986478 TTGAGATTCGAAGATTTTCCTGG - Intergenic
1031803927 7:126284450-126284472 CTAAGTGTTTAAAATTTTCTTGG - Intergenic
1032125640 7:129190444-129190466 GTATGATTCTAAAACTGTCCTGG + Intronic
1032179719 7:129664196-129664218 TTAAGGTTTTAAAATTTTCTGGG + Intronic
1032468468 7:132161561-132161583 CTGAGATTCTGCATTTTTCCAGG + Intronic
1033180322 7:139171102-139171124 CTAAGATTTTTAAATTTTATTGG - Intronic
1033876720 7:145828985-145829007 TTAAGATTTTTATATTTTCCTGG - Intergenic
1034176303 7:149102535-149102557 CTAACATTATAAGATTTTCCAGG - Intergenic
1034179241 7:149125217-149125239 CTAAGATTATAAAATTTCATTGG + Intronic
1034249825 7:149680152-149680174 CTAAAATTCTAAAACTTCCAAGG + Intergenic
1035405145 7:158591918-158591940 CCAAGATTCCAAGATTTTCAAGG + Intergenic
1036013165 8:4751021-4751043 CTAAGATTATCAAATCTTTCAGG + Intronic
1036122267 8:6031434-6031456 CTAAAATACAAAAATTATCCAGG - Intergenic
1036802130 8:11800856-11800878 CTAAGTTTTTAAGATTTTTCTGG + Intronic
1037114126 8:15202947-15202969 CAAAAATCCAAAAATTTTCCTGG + Intronic
1037158815 8:15741522-15741544 CTAAAATACTAAAGTTGTCCGGG + Intronic
1037426469 8:18760970-18760992 CTAAGATCCCAAGATTATCCTGG - Intronic
1037534725 8:19813802-19813824 CTAAAATTCAAAAATTAGCCCGG + Intergenic
1037598047 8:20370865-20370887 CTAAAATACAAAAATTATCCAGG - Intergenic
1037888116 8:22605659-22605681 TTAAGATTCTCCACTTTTCCGGG + Intronic
1037954093 8:23040028-23040050 CTAAAAATCAAAAATTATCCAGG + Intronic
1038965873 8:32571269-32571291 CTAAGATCCTAAAACATTTCTGG - Intronic
1039443807 8:37614142-37614164 CTAAGAATATAAAATTAGCCAGG + Intergenic
1039593040 8:38766766-38766788 CTTAGTTTCTCAACTTTTCCAGG - Intronic
1040433727 8:47369138-47369160 CTAAGATTCTCACATTGTGCAGG + Intronic
1040737642 8:50529316-50529338 CTCACATTCTGTAATTTTCCTGG - Intronic
1043322935 8:79012834-79012856 CAAAAATTCTAAAATTTACATGG - Intergenic
1043401323 8:79887715-79887737 CTCAGATTTTAGAAATTTCCAGG + Intergenic
1043429057 8:80176823-80176845 CTAAGATACAAAAATTAGCCAGG + Intronic
1043434015 8:80221014-80221036 TTAAGATTTTAAAATCTTCTTGG + Intronic
1043563288 8:81520389-81520411 CTGAGATTCTAGAATTTCCTTGG + Intergenic
1043574502 8:81642563-81642585 CTAAAATACAAAAATTTGCCGGG + Intergenic
1045100168 8:98836038-98836060 CTAAGATACAAAAATTAGCCGGG + Intronic
1045395062 8:101752498-101752520 CTAAGCTTTTAAAATTTGCCAGG - Intronic
1045889845 8:107142764-107142786 CTGAGATTCTATAATCTACCTGG + Intergenic
1047862245 8:128980547-128980569 CTAAGATTCTAAAATAGTTTTGG + Intergenic
1048721494 8:137330831-137330853 CTAAAAATATAAAATTATCCAGG + Intergenic
1048915675 8:139180850-139180872 CAAAAATTCTAAAATTTACGTGG + Intergenic
1049851742 8:144836047-144836069 CTAAAAGTATAAAATTTTTCTGG + Intronic
1050235458 9:3574512-3574534 CTACAATTCTAAAATATTCCTGG + Intergenic
1051802701 9:20954312-20954334 ATGAGAATCTAAAATTTTCATGG + Intronic
1051943805 9:22541486-22541508 CTAAGAGCCTAAAATTTACCAGG - Intergenic
1053159847 9:35806339-35806361 CTAAGATTCTGAAGATTCCCAGG - Intronic
1055114283 9:72590375-72590397 CTAAGATTCTACAATAGCCCAGG - Intronic
1055441448 9:76340482-76340504 CTAAAATACTAAAATTAGCCAGG + Intronic
1055475879 9:76663505-76663527 GTCAGATTCTAAAATTCTGCAGG + Intronic
1055932854 9:81577322-81577344 TTAAGAATCTATAGTTTTCCAGG - Intergenic
1056337104 9:85582950-85582972 CTGAGATACTAAGATTATCCTGG + Intronic
1056382649 9:86069042-86069064 CTTATATTCTACAATTTTCATGG + Intronic
1056867019 9:90236914-90236936 CTAAGTTTTTAAGTTTTTCCTGG - Intergenic
1059631158 9:116124182-116124204 CTAAGATCCTATAATCTTGCAGG - Intergenic
1059678326 9:116561939-116561961 CCAACATTTTAACATTTTCCTGG - Intronic
1060021717 9:120137247-120137269 CTATGAGTCTAAATTTGTCCAGG - Intergenic
1060717591 9:125947387-125947409 CTAAGACTCTTACGTTTTCCGGG + Intronic
1061675889 9:132215417-132215439 CTAAAATACTAAAATTAGCCGGG + Intronic
1061769601 9:132908168-132908190 TTAATATTTTAAAAATTTCCTGG - Intronic
1186025360 X:5304864-5304886 CAAAAATACAAAAATTTTCCAGG - Intergenic
1189075170 X:37906752-37906774 ATAGTCTTCTAAAATTTTCCTGG - Intronic
1189122349 X:38408124-38408146 CTAAGATTATATATTTGTCCGGG - Intronic
1190396095 X:49986540-49986562 CTAAGTTTCTAAAATCTTTTGGG + Intronic
1190974260 X:55384599-55384621 CTAATATCATAGAATTTTCCAGG + Intergenic
1192507222 X:71695238-71695260 CTAGGAATCAAAAATATTCCAGG + Intergenic
1192519475 X:71786314-71786336 CTAGGAATCAAAAATATTCCAGG - Intergenic
1192545335 X:72008158-72008180 TAAAGATTTTATAATTTTCCTGG - Intergenic
1192604709 X:72503915-72503937 CTAAGCTTCTAAGACTTGCCAGG - Intronic
1193125841 X:77869174-77869196 CTAAAATACAAAAATTATCCGGG - Intronic
1193954917 X:87848027-87848049 CTAAAAATATAAAATTATCCAGG + Intergenic
1194592836 X:95820944-95820966 TTAAGTCTCTAAAATTGTCCTGG - Intergenic
1194639756 X:96389791-96389813 TTAAGTTTCTAGAATGTTCCAGG + Intergenic
1194794253 X:98190856-98190878 ATAAAATTCTAAAAAGTTCCTGG - Intergenic
1194872839 X:99154064-99154086 GTAAGATTCTTTAATTATCCTGG - Intergenic
1195693386 X:107648027-107648049 CTAAGATTCTACATTTTAACAGG + Intronic
1197997829 X:132398761-132398783 CTAAGAGTTTAAAATTATCAAGG + Intronic
1198397333 X:136233433-136233455 CTAAAAATACAAAATTTTCCGGG - Intronic
1198487734 X:137105290-137105312 CGAAGATTCTAGAATTTTCAAGG + Intergenic
1198815137 X:140581295-140581317 CCTAGAATCTAAGATTTTCCAGG - Intergenic
1199294115 X:146138122-146138144 CTAAGAATACAAAATTTGCCAGG + Intergenic
1200177089 X:154124670-154124692 CAAAGATACAAAAATTATCCGGG + Intergenic
1201450788 Y:14111659-14111681 CTAAAATACCAAAATTTGCCAGG - Intergenic
1201689846 Y:16751581-16751603 CTAAGTTGCTAAAGTTGTCCTGG + Intergenic
1202347545 Y:23949262-23949284 CTAAAAATATAAAATTATCCAGG + Intergenic
1202523227 Y:25720829-25720851 CTAAAAATATAAAATTATCCAGG - Intergenic