ID: 1158584795

View in Genome Browser
Species Human (GRCh38)
Location 18:58722506-58722528
Sequence TGGTTTCTGCAGTAGCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158584795 Original CRISPR TGGTTTCTGCAGTAGCCATG TGG (reversed) Intronic
900436970 1:2635413-2635435 TGCTTCCTGCAGCAGCCCTGGGG + Intergenic
904848191 1:33436635-33436657 TGGTTTCTGTATTAGCAGTGGGG - Intergenic
907569412 1:55468995-55469017 TGGTTTCTGCAGAAGGCAGGTGG + Intergenic
908208579 1:61876665-61876687 TGGTTTATACAGTATACATGTGG - Intronic
912755732 1:112323502-112323524 TGGTTTCGGCTCTAGCCCTGAGG - Intergenic
912867366 1:113269790-113269812 TGGTTTCTCCAGAAGCCACTAGG - Intergenic
914941433 1:152026676-152026698 TGGTGGCAGGAGTAGCCATGCGG + Intergenic
916187686 1:162148780-162148802 TGGTTTCTCCAGTACCCACATGG - Intronic
916684840 1:167134947-167134969 AGGTTACTGCAGTAGCCAGGTGG + Intergenic
921196051 1:212759454-212759476 AGGATTCTGCAGTAGAAATGTGG - Intronic
1063887731 10:10596507-10596529 TGGTTTTTGCAGTAGCAACTGGG - Intergenic
1064218822 10:13422057-13422079 TTGGTTCTGCAGAAGCCAGGAGG - Intergenic
1064560384 10:16589845-16589867 TGGTTTGTGCAAGAGCCTTGTGG - Intergenic
1065100514 10:22326099-22326121 TGGCGTCTGCAGCAGCCTTGGGG + Intronic
1065271767 10:24040249-24040271 TGGTCTCTGGAGTAGCCACTTGG + Intronic
1065720628 10:28625681-28625703 TGCTTGCTGCAGTAAACATGGGG - Intergenic
1067414704 10:46094494-46094516 TCATTTCTGCAATAGTCATGGGG + Intergenic
1067434761 10:46269072-46269094 TCATTTCTGCAGTAGTCATAGGG + Intergenic
1067582849 10:47456383-47456405 TGGTCTCTGCAGAAGCCAGGAGG + Intergenic
1069644095 10:69979552-69979574 TGGTGTCTGTAGTGGCTATGAGG - Intergenic
1071146483 10:82579936-82579958 TGGTATCTGCAGTATCTGTGAGG + Intronic
1073946594 10:108757760-108757782 CTCTTTCTGCAGTAGCAATGGGG + Intergenic
1073951824 10:108818267-108818289 TGGTATCTGAATTAGGCATGTGG - Intergenic
1074411462 10:113232226-113232248 TGAGTTTTGCAGTAGCCCTGTGG + Intergenic
1075059680 10:119247049-119247071 TGCTTTCTGCAGTTGTGATGAGG + Intronic
1075575893 10:123577256-123577278 TACTTTCTGCAGTATCCCTGAGG + Intergenic
1075941061 10:126390272-126390294 TGTCTTCTGCCCTAGCCATGTGG + Intergenic
1076862035 10:133142220-133142242 TGGTTTCTGCTGCTGCCCTGGGG + Intergenic
1078562715 11:12387328-12387350 TTTTTTCTGCAGATGCCATGAGG + Intronic
1081984529 11:47291984-47292006 TGGTTTCTTGAGGAGCAATGAGG + Intronic
1084532338 11:69735032-69735054 TGGTTTGTGCTATAGTCATGTGG + Intergenic
1084556812 11:69880469-69880491 TGCTCTCTGTAGGAGCCATGAGG - Intergenic
1087056433 11:93941098-93941120 TGGTTTCTGCTTTGGCCATGGGG + Intergenic
1088573148 11:111242420-111242442 TGGTTTCTGCTGGATGCATGTGG - Intergenic
1089595945 11:119580248-119580270 TGGTATCTGTAGGAGCAATGGGG - Intergenic
1089781285 11:120874886-120874908 TGGTTTTTGCAGTTGGTATGGGG + Intronic
1090968605 11:131620267-131620289 TGGTTTTAGCTGTAGACATGAGG - Intronic
1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG + Intronic
1094307692 12:29039109-29039131 TGGTTTCAGTAGAACCCATGGGG - Intergenic
1098506894 12:71263481-71263503 TGGTTTCTTCATTCCCCATGAGG + Intronic
1102295793 12:111735627-111735649 TTGTTTTTGTAGTAGACATGGGG + Intronic
1103398870 12:120628855-120628877 GGGATAGTGCAGTAGCCATGGGG + Intergenic
1104761535 12:131299959-131299981 TGGGTCCTGCAGAAGCCGTGGGG + Intergenic
1104818241 12:131660833-131660855 TGGGTCCTGCAGAAGCCGTGGGG - Intergenic
1105988396 13:25592436-25592458 TAGTGGCTACAGTAGCCATGAGG + Intronic
1109462201 13:62676025-62676047 TGGTTTCTTTAATAGCCATGTGG + Intergenic
1111391282 13:87597723-87597745 TTGTTTCTGAAGTAGACCTGTGG - Intergenic
1111895383 13:94135617-94135639 TGGCTGATGCATTAGCCATGTGG - Intronic
1116646531 14:47535994-47536016 TGGGTTCTGCCATTGCCATGAGG - Intronic
1118263254 14:64268350-64268372 GGGTTACTGGGGTAGCCATGGGG - Intronic
1118736578 14:68705493-68705515 GGGTTTCTGAAGCAGCCAAGTGG - Intronic
1118808589 14:69258185-69258207 TGGTTTCCGCAGGAATCATGGGG - Intergenic
1120152998 14:81058127-81058149 TGGTTCTTGCAGTAGCAATGGGG - Intronic
1123901122 15:24878275-24878297 TGGTTGCGGTAATAGCCATGTGG - Intronic
1125504518 15:40259224-40259246 TGGCTGCTGCACCAGCCATGGGG - Intronic
1128724407 15:69977251-69977273 TGGTTTTGGCAGAAGCCAAGTGG - Intergenic
1133132442 16:3685601-3685623 TGGCTGCTGCTGTAGCCTTGTGG - Intronic
1133708408 16:8377871-8377893 AGGTTTCTGAATTAGACATGGGG - Intergenic
1134435238 16:14250737-14250759 GGGATTCTGCAGCAGCCTTGCGG - Intronic
1135753860 16:25080241-25080263 TGCTTTGTACACTAGCCATGGGG + Intergenic
1137957201 16:52843872-52843894 TGATTTCTGAAGTATCAATGGGG + Intergenic
1139224753 16:65223471-65223493 TGGTTTCTGCAGTTGCTGTGGGG - Intergenic
1141942811 16:87289674-87289696 TGGCTTCTGCAGGTCCCATGAGG - Intronic
1146599981 17:34205736-34205758 AGGTTTCAGCAATTGCCATGTGG + Intergenic
1146821084 17:35984157-35984179 TGGAGCCTGCAGGAGCCATGGGG - Intronic
1147946867 17:44085273-44085295 GGGTGGCTGCAGTGGCCATGGGG - Intronic
1151702051 17:75748741-75748763 TGGTCTCTGCAGTGTCCATGAGG + Intronic
1153369270 18:4295332-4295354 TGGTTTCTTCAGTAGCCTAATGG + Intronic
1154001893 18:10488756-10488778 TGGTTGTTGCAGGAGGCATGTGG + Exonic
1155017078 18:21854285-21854307 TGGTTACTACAGAAACCATGTGG - Intronic
1155339577 18:24800258-24800280 GCATTTCTGCAGTACCCATGGGG - Intergenic
1157903589 18:51544813-51544835 TGGTTTCTGCAGCATTGATGGGG + Intergenic
1158584795 18:58722506-58722528 TGGTTTCTGCAGTAGCCATGTGG - Intronic
1161731510 19:5963827-5963849 TGAATTCAGCAGCAGCCATGTGG - Intronic
1162211222 19:9093742-9093764 CGTTTTCTGCGGCAGCCATGAGG + Exonic
1163356240 19:16813137-16813159 TGGGCTCAGGAGTAGCCATGGGG + Intronic
925410558 2:3637521-3637543 TGTTTTCTACAGGAGACATGGGG + Exonic
926111591 2:10187495-10187517 TGTTTTCAGCAGTGGCCCTGGGG + Intronic
927492188 2:23527931-23527953 TGGGGTCTGCAGTAGCCTGGGGG - Intronic
928823807 2:35394397-35394419 ATGTTTCTACAGTAGCCATTAGG + Intergenic
932590582 2:73064317-73064339 TGGTTTTTGAAGTACCCAGGTGG - Intronic
935852809 2:107241646-107241668 TGGTTTGTGTAGTAGCCAAGAGG + Intergenic
936035691 2:109109086-109109108 TGCTTTCTGCACTAGACAGGAGG + Intergenic
936276600 2:111103116-111103138 TGTTTTCTTCAGTAGAGATGGGG - Intronic
937343811 2:121110215-121110237 TGGTATCAGCAGGAGCCATAAGG + Intergenic
938096783 2:128469364-128469386 TGGTTTCTGTTGTAGCCACAAGG + Intergenic
940330764 2:152472017-152472039 TGGATTGTGCACTAGCCATAAGG + Intronic
940789687 2:158018990-158019012 GGGTTTGTGGAGTAACCATGTGG - Intronic
940849981 2:158678849-158678871 TGGTCTCAGCAGTACCGATGTGG - Intronic
941470024 2:165873010-165873032 TTGTATCTGCAGTAGAGATGGGG - Intronic
942081018 2:172399627-172399649 TGGTGTCTTCAGAAGCCCTGAGG + Intergenic
942169822 2:173278902-173278924 TGTATTCTGGAGTATCCATGTGG + Intergenic
942797539 2:179839710-179839732 TGGTTCCTGCAGTATCCTTGTGG - Intronic
944201181 2:197108937-197108959 TGGCCTCTGCAAGAGCCATGTGG - Intronic
944826140 2:203484976-203484998 TGTTTTCTGCACTTACCATGTGG - Intronic
946835709 2:223770404-223770426 TGGGTCCTCCAGCAGCCATGGGG + Intronic
946962124 2:224996614-224996636 TGATTTTCGCAGTAGCCATAAGG - Intronic
947874703 2:233460450-233460472 TGGGGTCTGCATTACCCATGAGG + Intronic
948705434 2:239789413-239789435 TGGTTTCAGCAGGAACCCTGTGG - Intronic
948960348 2:241330250-241330272 TGTTTTCTGCACAAGCCCTGTGG - Intronic
1171284822 20:23928482-23928504 TGGTGTCTGCAACTGCCATGGGG - Intergenic
1172364159 20:34336040-34336062 CTGTTTCTGCAGTAGCCTGGTGG - Intergenic
1174109077 20:48185350-48185372 TGGATTATGAAGTGGCCATGAGG + Intergenic
1175214652 20:57385477-57385499 TTGTTTCTGCAGTGGCTGTGAGG - Intergenic
1175516595 20:59574283-59574305 TGGTCTCTCCAGTGGCCAAGGGG + Intergenic
1175946276 20:62560455-62560477 GGGTTTCTGCAGGAGCCTTTGGG - Intronic
1178583200 21:33853181-33853203 TGTGTTCTGCAGTGGCCATCAGG + Intronic
1179310193 21:40188541-40188563 TGGTTTGTGCTGTTGTCATGCGG - Intronic
1182308271 22:29386688-29386710 AGCTTTCTTCAGAAGCCATGTGG + Intronic
1182348691 22:29685774-29685796 TGGTTTCAGCAGTACCCATGGGG + Intronic
1183524113 22:38313838-38313860 CAGTTTCTGCAGGAGTCATGCGG - Intronic
950891292 3:16407039-16407061 TTGTTTCTGTAGTACCCAAGTGG - Intronic
951132391 3:19063166-19063188 TGGTTATTGCAGTAGCCAACTGG + Intergenic
952019879 3:29005407-29005429 TGGTATCTTGAGTAGTCATGGGG + Intergenic
952793523 3:37218716-37218738 TTGTATCTGCAGTAGAGATGGGG - Intergenic
953111444 3:39943910-39943932 TGTGTTTTGCAGTAGTCATGTGG + Intronic
955826060 3:62949090-62949112 TGGCTTCTCCTGTTGCCATGGGG + Intergenic
959877191 3:111397765-111397787 TGTTTTCTGAAGTTGTCATGAGG + Intronic
962343222 3:134602211-134602233 ATGGTTCTGCAGTGGCCATGTGG + Intronic
967633316 3:191772365-191772387 TGGTTTCTGCTGTTGTCATATGG + Intergenic
973107141 4:46354149-46354171 TGGCTTCTGCATTTGCCAAGAGG - Intronic
973997171 4:56470364-56470386 TTGTATCTTCAGTAGACATGGGG - Intronic
976045878 4:80946443-80946465 TGGTTTGTGCAGTAGCTTTTTGG - Intronic
977031956 4:91894206-91894228 TTGTTTCTGCAGTGGTCAGGTGG - Intergenic
977153025 4:93537705-93537727 TTGTTTCTCCATTAGCCTTGTGG + Intronic
977297249 4:95224672-95224694 TGGGTTCTGTTGTAGACATGGGG + Intronic
980944189 4:139302470-139302492 TCGTTTCTGGAGTAGGGATGAGG + Intronic
984062100 4:175002457-175002479 TAGATTCTGCTGGAGCCATGTGG - Intergenic
985547771 5:518705-518727 CCATTTCTGCAGTAGACATGAGG + Intronic
986936736 5:12897738-12897760 TTGTTTCTGCCGAAGGCATGTGG - Intergenic
987185052 5:15408920-15408942 ATGTTTCTGCAATATCCATGTGG - Intergenic
997711110 5:136005723-136005745 TGGGTTCCACAGTAGCCAGGAGG - Intergenic
998594711 5:143516597-143516619 TGTTTACTGCTGTAGCCTTGTGG + Intergenic
999285261 5:150390810-150390832 TGGTTCCTGCAGTATCCCTAGGG - Intronic
999320865 5:150614325-150614347 TGGCTTCTGCAATGGCCTTGGGG - Intronic
1007157049 6:39755280-39755302 TGGTTTCTTCACTTTCCATGAGG + Intergenic
1007516006 6:42411907-42411929 CGGTGTCTGCAGAAGCCATCTGG - Intronic
1009688352 6:66992197-66992219 TGGTTTCTGCAGTAGAAAAAGGG - Intergenic
1010272443 6:73929508-73929530 TGCTTTGTGCAATAGCCATGTGG + Intergenic
1016354974 6:143208947-143208969 TGGGTCCTGCAGTAGCCAAATGG + Intronic
1017445344 6:154502533-154502555 TGGTTTCTGCTCTATCCAGGTGG - Intronic
1017974958 6:159348682-159348704 TGGTTCCTTCTGTGGCCATGAGG + Intergenic
1018584632 6:165343739-165343761 TGATTTCTTCAGTAGCATTGAGG - Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021926701 7:25540790-25540812 TGGTTTTTGGTCTAGCCATGGGG + Intergenic
1023989889 7:45122395-45122417 AGGTTTCTGCAGGAGCCCAGGGG - Intergenic
1024140672 7:46460218-46460240 TGGTTTCTGCAGGAACAATTAGG - Intergenic
1024626167 7:51209999-51210021 TGGCTTCTGCCGTGGCCAGGTGG - Intronic
1028163275 7:87509690-87509712 TGGTTTCTGATGTATGCATGTGG + Intronic
1028173312 7:87625661-87625683 TGGATTCAGAAGTAGCCATCAGG - Intronic
1028206258 7:88020844-88020866 AGGTTTCTGCATTATCCATTGGG - Intronic
1029861328 7:103575590-103575612 CAGTTACTGCAGTGGCCATGGGG - Exonic
1031163674 7:118200176-118200198 AGCATTGTGCAGTAGCCATGAGG + Intergenic
1031850420 7:126856497-126856519 TTTTGTCTGCAGTAGCCTTGGGG + Intronic
1034709984 7:153182855-153182877 TAGTATCTGCAGGAGTCATGGGG + Intergenic
1035474961 7:159136821-159136843 TTGTTACTGCTGTGGCCATGTGG + Intronic
1036006036 8:4664385-4664407 TCGTTTCTACTGTAGACATGGGG - Intronic
1036023223 8:4872024-4872046 TATTGTCTGCAGGAGCCATGAGG - Intronic
1039092056 8:33841993-33842015 TGTTTTCAGCAGTTTCCATGCGG - Intergenic
1039221952 8:35341853-35341875 TGGTTTATGCAATAACCATGCGG + Intronic
1041627550 8:60047907-60047929 TGCTCTCTGCAGGAGCAATGTGG - Intergenic
1041981313 8:63864514-63864536 TGGTGTCTGTGGAAGCCATGTGG - Intergenic
1047051705 8:121119922-121119944 TGTTTTCTGCCCTAGTCATGTGG - Intergenic
1047976021 8:130131590-130131612 TTTTTTTTTCAGTAGCCATGAGG - Intronic
1049597259 8:143490402-143490424 TGGTCACTGCAGTTGGCATGTGG - Intronic
1050541912 9:6677881-6677903 TTGTATCTTCAGTAGACATGAGG - Intergenic
1052148787 9:25085747-25085769 TAGTTTCTGCAGTAGATTTGTGG + Intergenic
1053426303 9:38012376-38012398 TGGTTTCTCCATTAGTCAAGTGG + Intronic
1055744451 9:79427288-79427310 AAGTTTCTGCAGTGGCAATGAGG + Intergenic
1059223992 9:112654298-112654320 TGGTTTCTGCAATAACCATGTGG - Intronic
1060451837 9:123750093-123750115 TGTCTTCTGCAGTGGCCATGGGG - Intronic
1061683699 9:132258166-132258188 TGGTCTCAGCAGTACCGATGTGG + Intergenic
1062338243 9:136081936-136081958 TGAGTTCTGCAGGAGCCCTGGGG - Intronic
1186586252 X:10876280-10876302 TGGTTTCTGCAGGAAGCATAAGG + Intergenic
1187587406 X:20678765-20678787 TGACTTCTGCAGTAACCATGTGG + Intergenic
1194817652 X:98463997-98464019 TAGTTTCAACAGAAGCCATGTGG + Intergenic
1199008417 X:142729975-142729997 TGGTTTATGCAGAAGACATATGG + Intergenic