ID: 1158587798

View in Genome Browser
Species Human (GRCh38)
Location 18:58756384-58756406
Sequence AGACGAGACTAGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158587794_1158587798 -1 Left 1158587794 18:58756362-58756384 CCAGCACTAGGGGCAGAGCAACA No data
Right 1158587798 18:58756384-58756406 AGACGAGACTAGAGGGCAGAGGG No data
1158587793_1158587798 8 Left 1158587793 18:58756353-58756375 CCTCTGGGGCCAGCACTAGGGGC No data
Right 1158587798 18:58756384-58756406 AGACGAGACTAGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158587798 Original CRISPR AGACGAGACTAGAGGGCAGA GGG Intergenic
No off target data available for this crispr