ID: 1158590286 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:58773293-58773315 |
| Sequence | CTGGGAAATAGCAGAATAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1158590286_1158590293 | 30 | Left | 1158590286 | 18:58773293-58773315 | CCCACTATTCTGCTATTTCCCAG | No data | ||
| Right | 1158590293 | 18:58773346-58773368 | GATAGTGATACCAATGCTGGAGG | No data | ||||
| 1158590286_1158590292 | 27 | Left | 1158590286 | 18:58773293-58773315 | CCCACTATTCTGCTATTTCCCAG | No data | ||
| Right | 1158590292 | 18:58773343-58773365 | TAAGATAGTGATACCAATGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1158590286 | Original CRISPR | CTGGGAAATAGCAGAATAGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||