ID: 1158590286

View in Genome Browser
Species Human (GRCh38)
Location 18:58773293-58773315
Sequence CTGGGAAATAGCAGAATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158590286_1158590293 30 Left 1158590286 18:58773293-58773315 CCCACTATTCTGCTATTTCCCAG No data
Right 1158590293 18:58773346-58773368 GATAGTGATACCAATGCTGGAGG No data
1158590286_1158590292 27 Left 1158590286 18:58773293-58773315 CCCACTATTCTGCTATTTCCCAG No data
Right 1158590292 18:58773343-58773365 TAAGATAGTGATACCAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158590286 Original CRISPR CTGGGAAATAGCAGAATAGT GGG (reversed) Intergenic
No off target data available for this crispr