ID: 1158591354

View in Genome Browser
Species Human (GRCh38)
Location 18:58781475-58781497
Sequence AAACGCGCTCCTGGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158591354_1158591361 24 Left 1158591354 18:58781475-58781497 CCCTGAGCACCAGGAGCGCGTTT No data
Right 1158591361 18:58781522-58781544 TGTCTCACCCAGAGTTTCCCGGG No data
1158591354_1158591359 -8 Left 1158591354 18:58781475-58781497 CCCTGAGCACCAGGAGCGCGTTT No data
Right 1158591359 18:58781490-58781512 GCGCGTTTGGGAGATGTTATCGG No data
1158591354_1158591360 23 Left 1158591354 18:58781475-58781497 CCCTGAGCACCAGGAGCGCGTTT No data
Right 1158591360 18:58781521-58781543 CTGTCTCACCCAGAGTTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158591354 Original CRISPR AAACGCGCTCCTGGTGCTCA GGG (reversed) Intergenic
No off target data available for this crispr