ID: 1158592801

View in Genome Browser
Species Human (GRCh38)
Location 18:58791700-58791722
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158592801_1158592803 2 Left 1158592801 18:58791700-58791722 CCTGTGAGAAACAAAATTCTGTT No data
Right 1158592803 18:58791725-58791747 TTTATAAGGCATGCCATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158592801 Original CRISPR AACAGAATTTTGTTTCTCAC AGG (reversed) Intergenic
No off target data available for this crispr