ID: 1158593158

View in Genome Browser
Species Human (GRCh38)
Location 18:58794305-58794327
Sequence CTTCCTGCACAAATAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158593153_1158593158 12 Left 1158593153 18:58794270-58794292 CCATCAAAAAGTCAAGGGTTTTT No data
Right 1158593158 18:58794305-58794327 CTTCCTGCACAAATAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158593158 Original CRISPR CTTCCTGCACAAATAGAGGT GGG Intergenic
No off target data available for this crispr