ID: 1158597272

View in Genome Browser
Species Human (GRCh38)
Location 18:58827461-58827483
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158597272_1158597275 9 Left 1158597272 18:58827461-58827483 CCTTCACAGTGTTACAGTTCACA No data
Right 1158597275 18:58827493-58827515 AGGACTCAAAGAGTGAGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158597272 Original CRISPR TGTGAACTGTAACACTGTGA AGG (reversed) Intergenic
No off target data available for this crispr