ID: 1158597757

View in Genome Browser
Species Human (GRCh38)
Location 18:58831124-58831146
Sequence ATGGAGTTGCCCAATTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158597753_1158597757 1 Left 1158597753 18:58831100-58831122 CCAACTTCGAGTCCAGTTGTTAA No data
Right 1158597757 18:58831124-58831146 ATGGAGTTGCCCAATTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158597757 Original CRISPR ATGGAGTTGCCCAATTAGGA TGG Intergenic
No off target data available for this crispr