ID: 1158601482

View in Genome Browser
Species Human (GRCh38)
Location 18:58859720-58859742
Sequence AGGGCCTACCTGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158601482_1158601490 18 Left 1158601482 18:58859720-58859742 CCCTTCTCCTTCAGGTAGGCCCT No data
Right 1158601490 18:58859761-58859783 CCTTTCTCAGATACCTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158601482 Original CRISPR AGGGCCTACCTGAAGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr