ID: 1158610127

View in Genome Browser
Species Human (GRCh38)
Location 18:58932175-58932197
Sequence AAGCACAAGGAGAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1036
Summary {0: 1, 1: 1, 2: 6, 3: 74, 4: 954}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158610127_1158610132 -7 Left 1158610127 18:58932175-58932197 CCTCCCTCTTTCTCCTTGTGCTT 0: 1
1: 1
2: 6
3: 74
4: 954
Right 1158610132 18:58932191-58932213 TGTGCTTCTGTATCGAAAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 96
1158610127_1158610135 14 Left 1158610127 18:58932175-58932197 CCTCCCTCTTTCTCCTTGTGCTT 0: 1
1: 1
2: 6
3: 74
4: 954
Right 1158610135 18:58932212-58932234 GGTGAGGAGCCTCAGCTGATGGG 0: 1
1: 0
2: 1
3: 19
4: 158
1158610127_1158610134 13 Left 1158610127 18:58932175-58932197 CCTCCCTCTTTCTCCTTGTGCTT 0: 1
1: 1
2: 6
3: 74
4: 954
Right 1158610134 18:58932211-58932233 GGGTGAGGAGCCTCAGCTGATGG 0: 1
1: 0
2: 3
3: 29
4: 364
1158610127_1158610131 -8 Left 1158610127 18:58932175-58932197 CCTCCCTCTTTCTCCTTGTGCTT 0: 1
1: 1
2: 6
3: 74
4: 954
Right 1158610131 18:58932190-58932212 TTGTGCTTCTGTATCGAAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 107
1158610127_1158610133 -2 Left 1158610127 18:58932175-58932197 CCTCCCTCTTTCTCCTTGTGCTT 0: 1
1: 1
2: 6
3: 74
4: 954
Right 1158610133 18:58932196-58932218 TTCTGTATCGAAAGTGGGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158610127 Original CRISPR AAGCACAAGGAGAAAGAGGG AGG (reversed) Intronic
900701237 1:4049777-4049799 AAGGAGGGGGAGAAAGAGGGAGG + Intergenic
900877475 1:5354026-5354048 ACTCAAAAAGAGAAAGAGGGAGG - Intergenic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
901185287 1:7368952-7368974 AAGCAGAAGGAGGAAGGTGGAGG - Intronic
901284552 1:8066704-8066726 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
901306934 1:8239606-8239628 AAGGCCATGGAGGAAGAGGGAGG + Intergenic
901461343 1:9393602-9393624 AAGGACACGGAGAGAGAGGGGGG + Intergenic
901519065 1:9768922-9768944 AAGGAGAAAGGGAAAGAGGGAGG + Intronic
901941304 1:12664115-12664137 AAGAAGAAGAAGAAAGAGTGAGG + Intronic
902032759 1:13434679-13434701 AGCCACATGGAAAAAGAGGGTGG - Intergenic
902184196 1:14712846-14712868 AAGCACAGGGAAAAGGTGGGGGG - Intronic
902581106 1:17408170-17408192 AAGCACAAGGCGATCGAGGCTGG + Exonic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
902701940 1:18178646-18178668 GGGCACTGGGAGAAAGAGGGAGG - Intronic
903589045 1:24440447-24440469 AAGCCCAAGGAGAGACAGTGAGG - Intronic
903766966 1:25741299-25741321 AATCACTAAGAGAATGAGGGAGG + Intronic
903923248 1:26816210-26816232 AGGAAGAAAGAGAAAGAGGGAGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904087180 1:27917087-27917109 AAGCAGGAGGAGGAGGAGGGAGG - Intergenic
904092820 1:27957028-27957050 AGGCACAAGGGGAGAGTGGGAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904327249 1:29734889-29734911 AAGGAAAATGAGAAAGAGTGGGG + Intergenic
904412472 1:30332776-30332798 AATAACAAGGAGAGAGAGAGAGG - Intergenic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
905842144 1:41190538-41190560 AATCATTAGGAGGAAGAGGGAGG + Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906626781 1:47332135-47332157 AAGAAAAAGGAGAATGGGGGTGG + Intergenic
907110419 1:51921869-51921891 AATAATAGGGAGAAAGAGGGAGG - Intronic
908651478 1:66337570-66337592 AAGGACATGGGGAAAGAGGAGGG + Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909665402 1:78126783-78126805 AAGCACAATGAGAAAGAGGGAGG + Intronic
909823211 1:80092626-80092648 AAGCACAAGGACAAACATGGAGG - Intergenic
909960342 1:81832648-81832670 AAGAAAATGAAGAAAGAGGGTGG + Intronic
909991914 1:82233984-82234006 AAGCACATGGACAAAGGGAGGGG - Intergenic
910162056 1:84283729-84283751 CAGCACAAGGAGACAGAAGCTGG - Intergenic
910336604 1:86139165-86139187 AGGGAGAAGGAGAAAGGGGGGGG + Intronic
910524566 1:88163368-88163390 AAGCAAAAGGTGAAAGAAGTGGG + Intergenic
910547982 1:88440797-88440819 GAGGAGAAGGAGAAAGAAGGAGG + Intergenic
910774851 1:90864513-90864535 AAGAAGAAGAAGAAAGAAGGTGG - Intergenic
911014732 1:93320280-93320302 AAGCAGAATGAGCAAGAGGTGGG - Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911515965 1:98868254-98868276 AAGCATAAGGACTAAGAGGTAGG - Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912588235 1:110786997-110787019 AAGCTCAAAGAGAAAGAGAAAGG + Intergenic
912891957 1:113542775-113542797 AAACACACAGAGAAAGAGAGAGG + Intronic
913254431 1:116941057-116941079 AAGCACAAAGGGAGAGAGGCAGG - Intronic
913591874 1:120336814-120336836 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
913651482 1:120918332-120918354 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914169627 1:145210738-145210760 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
914247412 1:145896452-145896474 CAGCACATGGATAAAGAGGTGGG + Intronic
914524740 1:148454700-148454722 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
914598934 1:149181133-149181155 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914641660 1:149612435-149612457 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
914896481 1:151679505-151679527 AAGGACAAAGAGAACAAGGGAGG + Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
915606161 1:156952530-156952552 AAGGACAAGGGGAAATGGGGAGG + Intronic
915901005 1:159846802-159846824 GAGGACAAGGAGAGAGAGGTAGG + Intronic
916084093 1:161255783-161255805 AAGCCAAAGGAGAAGGAGAGGGG + Intergenic
916388469 1:164304320-164304342 AAGCAGAAAGAGAGAGAGAGAGG + Intergenic
916495628 1:165344369-165344391 GAGCAAGAGGAGAAAGAGTGAGG + Intronic
916942908 1:169694935-169694957 AAGGAAGAGGAGAAAGAGTGTGG - Intronic
916986803 1:170200535-170200557 AGAGACAAAGAGAAAGAGGGGGG - Intergenic
917009142 1:170451211-170451233 AAGGACATGGAGATACAGGGAGG + Intergenic
917539565 1:175899690-175899712 AAGGTAAAGGAGACAGAGGGAGG + Intergenic
917621089 1:176796797-176796819 AAGAAAGAGGAGAGAGAGGGAGG - Intronic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918175384 1:182039891-182039913 AGGCACATGGAAAAAGATGGAGG + Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919202715 1:194378088-194378110 AAGAAAAAGGAAAAAGAAGGAGG - Intergenic
919291519 1:195639509-195639531 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920053980 1:203179714-203179736 CAGGACAAAGAGAAAGAAGGAGG - Intronic
920222805 1:204416658-204416680 AAAGAAAAGAAGAAAGAGGGAGG + Intergenic
920776563 1:208943786-208943808 GAGAAAGAGGAGAAAGAGGGTGG + Intergenic
921034219 1:211360974-211360996 AAGGACCAGGAGAAGGAGAGAGG - Intronic
921035193 1:211371031-211371053 AAGCAGAGGGAAACAGAGGGAGG + Intronic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922389550 1:225125977-225125999 AAGAAGAAGGAGAGAGATGGGGG + Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923548738 1:234944189-234944211 AAGGACAAGGAGGAGGAAGGAGG + Intergenic
923827401 1:237515722-237515744 AAGGGGAAGGAGAAAGAAGGAGG - Intronic
923846354 1:237736967-237736989 AAGGAAATGAAGAAAGAGGGAGG + Intronic
923869304 1:237973692-237973714 AAGAACAAGGAGAAAGGAAGGGG - Intergenic
924436931 1:244049690-244049712 AAACACACGGGGAAAGAGGAAGG - Intronic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063010299 10:2015168-2015190 AAGAAGAATGAGAAAGAGAGAGG - Intergenic
1063044075 10:2373757-2373779 AAGGAAAAGGAGAGAGAGAGAGG - Intergenic
1063197840 10:3759694-3759716 AAGGACAGGGAAGAAGAGGGAGG + Intergenic
1063939644 10:11114091-11114113 AAGCAGAGGGAGAAATAGGGAGG - Intronic
1064076218 10:12270920-12270942 AAGCAGAAGTAGAGAGGGGGTGG - Intergenic
1064281545 10:13955800-13955822 AAGCACAATGAAAAGGAAGGTGG + Intronic
1064379918 10:14832323-14832345 AAGTAGAGGGAGCAAGAGGGAGG + Intronic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1064880253 10:20044131-20044153 AAGGAAAAAGAGAGAGAGGGAGG - Intronic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065184252 10:23156865-23156887 AAGGAGAAGGAAAGAGAGGGAGG + Intergenic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1065456726 10:25914154-25914176 AATGAGAAGGAGAAAGATGGGGG + Intergenic
1065546119 10:26822684-26822706 AAGGACAAGGGACAAGAGGGAGG + Intronic
1065752442 10:28899457-28899479 GAACACAAAGAGAAAGAGGAGGG - Intergenic
1065827939 10:29588915-29588937 AAGGACAAGGAATAAAAGGGGGG - Intronic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066683575 10:37959384-37959406 AACCACTGGGAGAAAGGGGGAGG + Intronic
1067152484 10:43748314-43748336 AAGCACAAGGAGAAATGAGTTGG + Intergenic
1067275164 10:44827673-44827695 ACGCACATGGAGGATGAGGGAGG - Intergenic
1067821461 10:49534598-49534620 AAGCACAGGGAAAAATAAGGGGG + Intronic
1068660767 10:59621177-59621199 AAGCAAAAGGAAAAAAAGTGAGG - Intergenic
1069319065 10:67145057-67145079 AAGGAGAAGGAGAAAGCTGGAGG + Intronic
1069917067 10:71793707-71793729 AAGAGAAAGGAGAAAGAAGGGGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070403761 10:76076392-76076414 AAGAAGAAAGAGAAAGAGAGAGG - Intronic
1070470300 10:76772677-76772699 AAGGTCATGGAGAAAAAGGGAGG + Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071238151 10:83673571-83673593 AGGCACTAGGAGCAACAGGGAGG + Intergenic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071439068 10:85674274-85674296 AACCAAATGGAGAAAGAGGCAGG - Intronic
1071497564 10:86179316-86179338 GAGAGCAAGGAGAAAGATGGAGG - Intronic
1071836508 10:89423655-89423677 ATGTACAAGCAGAAAGAGAGGGG - Intergenic
1072405321 10:95146987-95147009 AGGGACAAAGGGAAAGAGGGTGG - Intergenic
1073302679 10:102480535-102480557 TACCACAGGGAGACAGAGGGAGG - Exonic
1073576706 10:104631937-104631959 AAGCAAAAGGAAGAAGAGGGAGG - Intergenic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073669360 10:105570456-105570478 AAGCAAAAGAACAAAGATGGAGG + Intergenic
1073778945 10:106815845-106815867 AAGTGCAAGGAGGAAGTGGGAGG + Intronic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074866766 10:117548505-117548527 AGAGAGAAGGAGAAAGAGGGAGG + Exonic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1075627728 10:123974552-123974574 AAGGAGAAGGAGCAAGAGTGAGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076252394 10:128994764-128994786 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1076858930 10:133130610-133130632 ACAGACAAGGAGGAAGAGGGAGG - Exonic
1077881418 11:6353656-6353678 AGGCCGAAGGAGGAAGAGGGAGG + Intergenic
1077892029 11:6425745-6425767 AACCACATGGACAAAGAGTGGGG - Intergenic
1078192827 11:9106572-9106594 AAGAGCAAGGAGCAAGGGGGAGG + Intronic
1078290601 11:10006716-10006738 AAGCTCCAGGAGGAAGTGGGAGG - Intronic
1078451400 11:11443527-11443549 ACCAATAAGGAGAAAGAGGGTGG + Intronic
1078593373 11:12665234-12665256 GAGCAGGAGGAGAAAGAAGGAGG + Intergenic
1079067919 11:17313697-17313719 AAGCATTTCGAGAAAGAGGGAGG - Intronic
1079132560 11:17756030-17756052 AAGTGCAAGAAGAAGGAGGGAGG + Intronic
1079251316 11:18790256-18790278 AGCCCCAAGGAGAAAGAGGTGGG + Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079382461 11:19949898-19949920 GAGCACACAGAGAAACAGGGAGG - Intronic
1079511631 11:21217119-21217141 AAGTACAGGGTGAAGGAGGGGGG - Intronic
1079552828 11:21721749-21721771 AAGCAGGAGGAGCAAGAGGGAGG - Intergenic
1079929944 11:26545790-26545812 TAGAGCAAGGAGGAAGAGGGAGG - Intronic
1080259925 11:30337699-30337721 AAGCACAAGCAATAAAAGGGTGG + Exonic
1080297353 11:30745454-30745476 AATCAGAAGGAAAAAGAGGTAGG + Intergenic
1080360277 11:31505730-31505752 GAGCAGAAGGAGGAAGAGGAGGG - Intronic
1080364251 11:31552667-31552689 AAGCAAAGGTAGAAACAGGGAGG - Intronic
1080951207 11:37035308-37035330 AAGAAGAGAGAGAAAGAGGGAGG - Intergenic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1081298032 11:41415976-41415998 AAGCTCAAAGAGAGAGAGAGAGG - Intronic
1082228797 11:49740215-49740237 AAGGACAAGAAGCAAGATGGAGG + Intergenic
1083091652 11:60206093-60206115 AAGCAGAAGGAAAAGGATGGGGG + Intronic
1083335552 11:61919709-61919731 AGGCAGAGGGAGATAGAGGGAGG - Intronic
1083727508 11:64636260-64636282 AAGGAGAAGGGGAGAGAGGGTGG - Intronic
1085807668 11:79651109-79651131 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086302510 11:85442922-85442944 AAGAAGAAGGAGGAAGAAGGAGG + Intronic
1086621269 11:88888908-88888930 AAGGACAAGAAGCAAGATGGAGG - Intronic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088809644 11:113382655-113382677 AACCCCAAGGAGAAAGAGAAAGG - Intronic
1089020870 11:115213191-115213213 GAGCACATGCAGAAAAAGGGAGG + Intronic
1089739974 11:120575724-120575746 AAGCACAAGGAGAAGAGAGGAGG - Intronic
1089930718 11:122308537-122308559 ATACACAAGAAGAAAGAGGGTGG + Intergenic
1090164632 11:124534149-124534171 AGGCAAAAAGAGAAAGAAGGAGG - Intergenic
1090187589 11:124748402-124748424 AAGCCCAAGGAGACATATGGGGG - Exonic
1090274751 11:125411520-125411542 AAGGACAAGGAGGAAGAGATGGG - Intronic
1090422694 11:126586479-126586501 AATGACAAGCAGAAAGAGGGCGG - Intronic
1090603432 11:128396095-128396117 TAGAACAAAGAGACAGAGGGAGG + Intergenic
1091215056 11:133895971-133895993 GAGCAAAAGCAGAAAGGGGGTGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1092069589 12:5621846-5621868 AAAAAGAAGGAGGAAGAGGGAGG + Intronic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1093255542 12:16862684-16862706 TTGCAAAAGGAGAAAGAAGGAGG - Intergenic
1093743609 12:22715139-22715161 AGTAAGAAGGAGAAAGAGGGAGG - Intergenic
1094070294 12:26405149-26405171 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1094337139 12:29372382-29372404 AAGAAGAAGAAGAAAGAAGGTGG + Intronic
1094369392 12:29720224-29720246 AGACACAAGGAGAAAGAGTATGG - Intronic
1094447758 12:30550213-30550235 AAGCAGGAGGAGGAAGAGGAGGG - Intergenic
1094498127 12:31001984-31002006 AAGAACAAGCAGAGACAGGGTGG + Intergenic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1094635544 12:32223859-32223881 AGGCCCAAGGAGAAAGAGATGGG + Intronic
1094778242 12:33757831-33757853 GAGCCCAAGGGGAAAGAGGAGGG - Intergenic
1095382057 12:41606778-41606800 AGGCAGAAAGAGAAGGAGGGAGG - Intergenic
1095409947 12:41910715-41910737 TAGCACAAAAAGAAAGTGGGTGG - Intergenic
1095531428 12:43190748-43190770 AAGAAAGAGGAGAAAGATGGAGG - Intergenic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095936872 12:47693245-47693267 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1096089930 12:48892290-48892312 AAGGAGAAAGAGAAAGAGAGAGG - Intergenic
1096112526 12:49037979-49038001 AAGCCCAAGGTGGAGGAGGGTGG - Exonic
1096391452 12:51232314-51232336 AAGCAGAAGGGGAAGGAAGGAGG - Intergenic
1096709597 12:53445522-53445544 AAGCACAATGGGAAAAAGTGGGG - Intronic
1096749958 12:53752192-53752214 AGGCAGAAAGAGACAGAGGGTGG - Intergenic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097533569 12:60837093-60837115 AAGAACAAAGAGAAAGTTGGAGG - Intergenic
1098165671 12:67695122-67695144 AACCACAGGGATAAAGAGCGTGG - Intergenic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098758957 12:74399709-74399731 GAACACAAGGAGGAAGAGTGAGG - Intergenic
1099603740 12:84775125-84775147 AAGAATATGGAGAAAGAGAGGGG - Intergenic
1099713318 12:86257481-86257503 AAGCACCTGGAGAAAGAGCAAGG + Intronic
1101748373 12:107561773-107561795 TAGCTTAAGGAGTAAGAGGGGGG - Intronic
1102202562 12:111067767-111067789 GAGAACAAGGGGACAGAGGGAGG + Intronic
1102252012 12:111393950-111393972 AAGCAGAAGTAGAAAGCGGAGGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103262203 12:119597112-119597134 AAGGACAAAGAGGAAGAGGAAGG + Intronic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1104232486 12:126898637-126898659 AAGAAAGAGGAGAAAAAGGGAGG + Intergenic
1104292067 12:127479381-127479403 AATCACAAGGAGAAAGAGAGAGG - Intergenic
1104713591 12:131002826-131002848 AAGCACAGGGAGGTAGGGGGAGG + Intronic
1104725536 12:131073251-131073273 AAGCACCAAGAGATAGAGGCTGG + Intronic
1105337720 13:19489045-19489067 AAGGAGAAGGAGAAAGATGGGGG + Intronic
1105426193 13:20297041-20297063 GAGGACAGGGAGACAGAGGGCGG - Intergenic
1105560062 13:21481947-21481969 AACAACATAGAGAAAGAGGGTGG + Intergenic
1105630374 13:22157635-22157657 AAGAGCCAGGAGCAAGAGGGAGG + Intergenic
1105813511 13:24013663-24013685 AGGGACAAGGAGCAAGTGGGTGG - Intronic
1105916435 13:24921344-24921366 AAGAACAAAGAGAAAGCTGGAGG - Intronic
1106456156 13:29929183-29929205 AAGCACAATGGGAAATGGGGAGG + Intergenic
1107026796 13:35810017-35810039 AAGCAGAAGGAATAACAGGGTGG - Intronic
1107180463 13:37452854-37452876 CAGCACAAAATGAAAGAGGGTGG - Intergenic
1107527292 13:41245884-41245906 CAGGACAGGGATAAAGAGGGAGG - Intronic
1107946302 13:45420008-45420030 AGGGGAAAGGAGAAAGAGGGAGG + Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108105885 13:47008616-47008638 AAGACCAATGAGAAAGAGTGGGG - Intergenic
1108266800 13:48718610-48718632 AAGCAAAAGGACAAAGTTGGAGG - Intergenic
1108521513 13:51250910-51250932 AGGCACAAGGCGAATGATGGAGG - Intronic
1108718367 13:53104863-53104885 AGACACAAGGAGAAAGAGAAAGG - Intergenic
1109039132 13:57309079-57309101 AAGAAAAAGGAGAAAGAAGTGGG - Intergenic
1110063111 13:71066723-71066745 AAGGAAAAGGAGAAAGAGAGAGG - Intergenic
1110133497 13:72036594-72036616 AGGCACAAGGAGAAAAGGGTGGG + Intergenic
1111396472 13:87673492-87673514 AAGCACAGGGAGGGAGGGGGAGG + Intronic
1111497764 13:89075795-89075817 AAGCAAAAGGCAAAAGAGGAAGG + Intergenic
1111728270 13:92040570-92040592 AAACCAAAGGAGAAATAGGGTGG - Intronic
1112496759 13:99911400-99911422 AATCAGAGGGAGAAACAGGGAGG - Intergenic
1112832121 13:103465891-103465913 AAGAACTGGGAGAAAGAAGGAGG - Intergenic
1112874789 13:104023954-104023976 CATCACATGGTGAAAGAGGGAGG + Intergenic
1112907990 13:104447449-104447471 AATCTCACAGAGAAAGAGGGAGG - Intergenic
1113258606 13:108534779-108534801 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1113502867 13:110792261-110792283 ATGCACATGGAGAGAGAGGAAGG + Intergenic
1113975684 13:114225681-114225703 ACGGACAAGGAGAAAGAAGGAGG + Intergenic
1113976681 13:114232724-114232746 AAGCAGGAGGAAAAAAAGGGAGG - Intergenic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114332655 14:21652702-21652724 AAGGACAAGGAAAAAGGCGGTGG - Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114466889 14:22929355-22929377 CAGCGCGAGGAGAAAGATGGCGG - Exonic
1114541886 14:23466837-23466859 AGGCTGGAGGAGAAAGAGGGAGG + Intergenic
1114643155 14:24238120-24238142 AAGCAGAAGGAGGAAGACGCTGG + Intronic
1114657675 14:24325813-24325835 AAGGAGATGGAGAAAGAGGTGGG - Exonic
1114881905 14:26796717-26796739 AAGAAGAAAGAGAAAGAAGGAGG + Intergenic
1115122246 14:29951374-29951396 AAGCACAAGAAGACAAAGGTTGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115329029 14:32173856-32173878 AAGAAGAAAGACAAAGAGGGAGG - Intergenic
1115410895 14:33073429-33073451 CAGGGCAAGGAGATAGAGGGTGG + Intronic
1115475549 14:33809894-33809916 AAACACATTGAGAAAGATGGAGG + Intergenic
1115654490 14:35430471-35430493 AAGCCAAACGAGAAAGAGAGTGG + Intergenic
1115790169 14:36869343-36869365 ACCCACAGGGACAAAGAGGGTGG + Intronic
1115902764 14:38172025-38172047 AAGCACAAGGAGAGAGTCAGAGG - Intergenic
1116654390 14:47632791-47632813 AATCAGAAGGAGAGAGAGGTTGG - Intronic
1116828787 14:49697280-49697302 AAGGAGAGGGAGAGAGAGGGGGG + Intronic
1117187091 14:53251017-53251039 GAGCAGGAGGAGAAGGAGGGAGG - Intergenic
1117212910 14:53519831-53519853 AAGAACGAGAAGAAAGAGAGGGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1118538896 14:66801632-66801654 TAGCTCAAGGAGAGAGAGGGGGG - Intronic
1118977368 14:70689195-70689217 AAGAACAAAGAGCAAGATGGGGG + Intergenic
1119335851 14:73833054-73833076 AAGAAAAGGGAGAAAGAAGGAGG + Intergenic
1119428717 14:74552044-74552066 GAGGGCCAGGAGAAAGAGGGAGG + Intronic
1119663306 14:76466292-76466314 AAACACAAGGAGAATGTGGCTGG - Intronic
1119951608 14:78751440-78751462 GAGCACAAGGAGGGACAGGGAGG - Intronic
1120222139 14:81746724-81746746 AAGGAAAAGCAGAAAGGGGGTGG - Intergenic
1120701712 14:87705564-87705586 AAGCATGATGAGAAAGAGGGTGG + Intergenic
1120969681 14:90197021-90197043 AATTAGGAGGAGAAAGAGGGTGG - Intergenic
1121122273 14:91383445-91383467 GTGCCCAAGCAGAAAGAGGGAGG - Intronic
1121552895 14:94815565-94815587 AAGCATAAGGAAAAGGAGCGAGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122357384 14:101131889-101131911 AAGCAGAAGTAGGAGGAGGGAGG - Intergenic
1122384767 14:101336821-101336843 AAGAACAAGAAGAAAGACGTGGG + Intergenic
1124216678 15:27813110-27813132 AGGAACAAGGAGAAAGGGGCAGG + Intronic
1124863934 15:33470891-33470913 AAGCAAAATGAGAAAAAAGGAGG + Intronic
1124993402 15:34698270-34698292 AAGCATAAGGAGTAAGAAAGTGG - Intergenic
1125480633 15:40077275-40077297 AAAAAGAAAGAGAAAGAGGGAGG + Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1126259576 15:46672587-46672609 AAGAACAAAGAGAAAGGTGGTGG + Intergenic
1126553995 15:49965965-49965987 AAGGGCAAGCAGAAATAGGGTGG + Intronic
1126828235 15:52572275-52572297 AAGCCCAAGGAGAGAGAGACAGG - Intergenic
1127043736 15:55004272-55004294 AAGCACACACAGAAAGCGGGGGG + Intergenic
1127292435 15:57582438-57582460 AAAGACTTGGAGAAAGAGGGAGG - Intergenic
1127365342 15:58284283-58284305 GGGCACAGGGAGAAGGAGGGAGG + Intronic
1127909353 15:63403310-63403332 AAGCAGAAGAGGAAAGAAGGAGG - Intergenic
1127992682 15:64132484-64132506 GATCACCAGGAGAAAGAGTGAGG - Intronic
1128029611 15:64468302-64468324 AAGCAGAAGGAGGAGGAGAGAGG - Intronic
1128149908 15:65356163-65356185 AAACACTTGGAGAAAGAGTGGGG + Intronic
1128364254 15:66986125-66986147 AACCAGAAGGAGAAGGAGTGTGG - Intergenic
1128388751 15:67168652-67168674 AGGCACAAGGAGGAAGAGGAGGG - Intronic
1128769119 15:70268747-70268769 AGGCACCAAGAGAAAGTGGGAGG - Intergenic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129289814 15:74556259-74556281 AAGAAGAGGGAGAAAGATGGAGG + Intronic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130664259 15:85855956-85855978 AAGCAAGAGAGGAAAGAGGGAGG - Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130784287 15:87078787-87078809 AACCACAATGAGAAACAGGGAGG - Intergenic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1131174076 15:90199271-90199293 AGTAACCAGGAGAAAGAGGGTGG + Intronic
1131354739 15:91734914-91734936 AAGAAGAGGAAGAAAGAGGGAGG + Intergenic
1131827307 15:96331753-96331775 CAGAACGTGGAGAAAGAGGGAGG - Exonic
1131847200 15:96500602-96500624 AATCTCAAGGAAAAAGAGGGTGG + Intergenic
1132358747 15:101193981-101194003 GAGCACATGGAGGAAGAAGGTGG - Intronic
1132681381 16:1143686-1143708 AAGCCCAAAGGGAATGAGGGGGG + Intergenic
1132761141 16:1509165-1509187 AAGCACCAGGAGGAGCAGGGGGG + Intronic
1133064386 16:3195730-3195752 AAACAGAAAAAGAAAGAGGGTGG - Intergenic
1133075479 16:3277285-3277307 CTGTCCAAGGAGAAAGAGGGGGG + Intronic
1133588304 16:7217048-7217070 AAGGAGAGGGAGAGAGAGGGAGG - Intronic
1133823242 16:9255503-9255525 AAGAACAAAGAGAAAGTTGGAGG + Intergenic
1133878761 16:9761113-9761135 AATCATAGGGAGACAGAGGGAGG - Exonic
1133887359 16:9843000-9843022 AAACAGAAAGAGAAAAAGGGGGG + Intronic
1134557411 16:15177380-15177402 AAGGAAAAGGAAAGAGAGGGAGG + Intergenic
1134615891 16:15650687-15650709 AAGGAAGAGGAGAAAGAGGATGG - Intronic
1134772957 16:16826510-16826532 AATTAAAAGGAGAAAGAGGGTGG - Intergenic
1134917981 16:18089059-18089081 AAGGAAAAGGAAAGAGAGGGAGG + Intergenic
1135604843 16:23814568-23814590 AGGGACAAGGAGATAGAGGAAGG - Intergenic
1135963420 16:27016402-27016424 AAGAAGAAGGAGGAAGTGGGGGG - Intergenic
1136274695 16:29172121-29172143 TAGCCCAGGGAGACAGAGGGTGG + Intergenic
1136574398 16:31114916-31114938 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
1136656623 16:31713141-31713163 AAGCAGAACGAGTGAGAGGGCGG + Intergenic
1137021803 16:35435553-35435575 AAGCCTAAGGAAAAAGAGTGAGG - Intergenic
1139082742 16:63544204-63544226 AAGGACAAAGAAAAAGAAGGAGG + Intergenic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139196299 16:64922024-64922046 AAGGAAAAGGAGAAAGAGAAAGG - Intergenic
1139769303 16:69260407-69260429 AGGTAGAAGGAGAAAAAGGGAGG - Intronic
1139840348 16:69873525-69873547 CAGCACAAGGATACAGTGGGTGG - Intronic
1140345521 16:74209328-74209350 AAGAAAATGGAGGAAGAGGGAGG + Intergenic
1140398966 16:74654498-74654520 AATCCCAAGGAGAGGGAGGGAGG - Intronic
1141118123 16:81329146-81329168 AAACAACAGGAGAAAAAGGGTGG - Intronic
1141224079 16:82098812-82098834 AGAGACAAGGAGAAAGAGAGAGG + Intergenic
1141304423 16:82848069-82848091 AAGAACAAAGAGAAAGTTGGAGG + Intronic
1141320638 16:83005334-83005356 ATGAACAGGGAGAAAGAGTGAGG - Intronic
1141345041 16:83237030-83237052 GAGGACCAGGAGGAAGAGGGTGG + Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141766665 16:86063690-86063712 AAGGAGAGGGAGGAAGAGGGAGG + Intergenic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141942488 16:87286897-87286919 AAACACAAGGAGGAAGGGGCAGG + Intronic
1142072350 16:88098138-88098160 AAGCGCATGGAGAAAGATGAGGG - Intronic
1142078989 16:88137879-88137901 TAGCCCAGGGAGACAGAGGGTGG + Intergenic
1143262606 17:5611185-5611207 AAGCTCAAGGAGGAAGTGGCCGG + Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143711284 17:8736926-8736948 AAGCAGAAGAAGAAAGAAAGAGG + Intronic
1143711291 17:8736970-8736992 AAGAAGAAAGAGAGAGAGGGAGG + Intronic
1143711492 17:8739104-8739126 AAGAAAAAAGAGAAAGAGAGGGG + Intronic
1143869468 17:9947897-9947919 AAGCAGGAGGAGGAAGAGGAGGG - Intronic
1143887611 17:10076399-10076421 AAGAAAAAAGAAAAAGAGGGAGG + Intronic
1144023860 17:11260645-11260667 AGGCACCAGGAGACAGAGAGAGG - Intronic
1144425186 17:15134720-15134742 AAGCAAAAGGAAAAAGTGTGGGG + Intergenic
1144466555 17:15502139-15502161 AAGGACATGGAGAGAGATGGGGG - Intronic
1146007033 17:29166900-29166922 AAAGACAAGGACAAAGATGGCGG - Exonic
1146325001 17:31878567-31878589 ACCCACAAGGAGAGAGAGAGTGG + Intronic
1146502888 17:33379578-33379600 CAGCACAAGGTGCGAGAGGGAGG - Intronic
1146736388 17:35242556-35242578 AATTACTAGGAGAAGGAGGGAGG + Intergenic
1147370893 17:39992302-39992324 GAGCGCAGGGAGAGAGAGGGCGG + Intronic
1147715985 17:42508979-42509001 AAGCACTAGGAGGAGCAGGGAGG - Intronic
1147846941 17:43411121-43411143 AAACAGAAAGAGAAAGAAGGTGG - Intergenic
1148807081 17:50269357-50269379 AAGCAGAAAGAGTAAGAGGAGGG + Intergenic
1148853035 17:50563917-50563939 TACCACAAAGAGAAAGAGGGAGG - Intronic
1148907185 17:50919076-50919098 AAGCACAAGGCGGGAGAGGGTGG - Intergenic
1148937051 17:51171740-51171762 AAGCACAAGGAGACAGTGTCCGG - Exonic
1149079249 17:52633605-52633627 AAGGAAAAGGGGAAAGAAGGAGG - Intergenic
1149353167 17:55812535-55812557 AAGCACCAAGAGAAAGTGTGAGG + Intronic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150023357 17:61644210-61644232 AAAGAGAAGGAGAAAGAGAGAGG - Intergenic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150462870 17:65367088-65367110 AAGCCAAAGGAGAAAGAGTCAGG - Intergenic
1150477872 17:65488186-65488208 AGGGACAAAGAGAGAGAGGGAGG + Intergenic
1150593067 17:66579899-66579921 AAGCACCAAGTGAAAGAAGGAGG - Intronic
1151088454 17:71407798-71407820 AACCACAAGTGCAAAGAGGGAGG + Intergenic
1151219618 17:72602878-72602900 CAGCACCAGGTGACAGAGGGAGG + Intergenic
1151249156 17:72820412-72820434 AGGCACAAGGAAAATTAGGGAGG - Intronic
1151557770 17:74855126-74855148 AAGCACAGGGAGAGAGACAGAGG + Intronic
1151676943 17:75603434-75603456 GAGGACGAGGAGAGAGAGGGAGG - Intergenic
1153331298 18:3878361-3878383 AAACACAAGGAGACAGTGGCAGG + Intronic
1153500426 18:5743860-5743882 ATGGACCAGGAGAAAGAGTGTGG - Intergenic
1153566418 18:6422729-6422751 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1154266552 18:12883891-12883913 AACCAAAAGGAGCAAGAGAGCGG + Intronic
1154364922 18:13698939-13698961 ACACACACAGAGAAAGAGGGCGG - Intronic
1154989237 18:21584738-21584760 GAGCCCAAGGAGATAGAGGCTGG + Intronic
1155070046 18:22307058-22307080 AGGCACAGGGAGAAGAAGGGTGG + Intergenic
1155153966 18:23143262-23143284 AAGCACAGGCAGGCAGAGGGCGG - Intronic
1155178504 18:23322624-23322646 ATGCCCAAAGAGAAAGATGGAGG - Intronic
1155266168 18:24095940-24095962 AAGGAGAGGGAGAAAGAAGGGGG + Intronic
1155589787 18:27413633-27413655 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1155838179 18:30613383-30613405 AAGCACAGAGAGAGAGAGAGAGG - Intergenic
1156110852 18:33725424-33725446 AAGCAAAAGTAGAAAGAGGTAGG - Intronic
1156354007 18:36325680-36325702 AAAGAGAAGGAGAAAGAGAGAGG - Intronic
1156597625 18:38565778-38565800 AGGGACAAGGAGAAAAAGAGGGG - Intergenic
1156685585 18:39641634-39641656 AAGTACAAGGAGTAACAGGACGG + Intergenic
1156695386 18:39760354-39760376 AAGCACATGGAAAAACAGAGGGG + Intergenic
1156729861 18:40179666-40179688 ATGCACAAGAAGAAAGAAAGTGG - Intergenic
1156782750 18:40870751-40870773 AAGCACAAGGGGAAAGGTGAAGG - Intergenic
1157854015 18:51087367-51087389 AAGCACCTGGAAAAAGAGCGAGG + Intergenic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1158617350 18:59000485-59000507 AAGCAAATGGAAAAAGATGGTGG - Intergenic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158701021 18:59746880-59746902 AAGTAGAAGGAGAAAGTTGGAGG - Intergenic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1159479972 18:68977453-68977475 AATCACAAGGACATAGAGAGGGG - Intronic
1159605810 18:70473604-70473626 AAAGACAAGGGGAAAGAGAGAGG - Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1159951866 18:74489971-74489993 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1159971592 18:74662484-74662506 AAGCATAAGGAGAAATAAGTAGG + Intronic
1160274190 18:77415392-77415414 AAGGACAAAGAGAAAGAACGAGG - Intergenic
1160307621 18:77754783-77754805 AACCACAAAGAAAAAGAGGCAGG + Intergenic
1160947440 19:1650311-1650333 ATGGACAGGGAGAAACAGGGAGG + Intronic
1161351807 19:3797240-3797262 AAGAAAAAGTAGAAAGTGGGGGG - Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1162103047 19:8352188-8352210 AAGAAGAAAGAAAAAGAGGGAGG + Intronic
1162141205 19:8586465-8586487 CAGCACCTGGAGAAAGGGGGCGG + Exonic
1162910122 19:13843694-13843716 AGGCACACCGGGAAAGAGGGAGG - Intergenic
1163741129 19:19013573-19013595 AGGCACAAGGGGAAGGAGGGAGG - Intronic
1163783460 19:19262258-19262280 AAGCAGAGGGAGAGAGAGAGAGG + Intronic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1164493087 19:28732142-28732164 AAGGAGAAGGAGAAAGAAGGAGG + Intergenic
1164570072 19:29367858-29367880 AAGCAGAAGGAGGAGGCGGGAGG - Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164645212 19:29854295-29854317 ACTCAGAAGGAGGAAGAGGGTGG + Intergenic
1164753489 19:30672790-30672812 AAGTACAAGGAGGGAGTGGGGGG + Intronic
1165249898 19:34521847-34521869 AAAAAAAAGGAGAAAGAGAGAGG - Intergenic
1165379581 19:35468849-35468871 TAGCACAATGAGAAAGTGTGGGG - Intergenic
1165390774 19:35537458-35537480 AAGCAAAGGGAAAAGGAGGGAGG + Intronic
1165454315 19:35901898-35901920 AGGGAAATGGAGAAAGAGGGAGG - Intronic
1165873513 19:38989648-38989670 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1166635236 19:44445449-44445471 GAGCAGAATGAGAAAGAGGGAGG - Intronic
1166649371 19:44560134-44560156 AAAGAAAAGGAGAAAGAGGGAGG + Intergenic
1166793058 19:45409238-45409260 AAGAAGAAGAAGAAAGAGAGAGG + Exonic
1167464798 19:49645104-49645126 AGGCAGAAGGAGAAAGCGTGGGG - Exonic
1167626411 19:50592725-50592747 AAGGAAAAGAAGAAAGAAGGAGG - Intergenic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
1167780614 19:51596442-51596464 AAAAACAAGAACAAAGAGGGAGG + Intergenic
1168082110 19:54017718-54017740 AAGTAAAAGGAGGAGGAGGGAGG - Intergenic
1168159578 19:54500790-54500812 AAGCCCAGGGAGCAAGTGGGAGG - Intronic
925485274 2:4321860-4321882 GAGAACAAGGAGAAAAAGGAAGG - Intergenic
925718800 2:6808848-6808870 AGGTGCAAGGAGAAAGAGTGAGG + Intergenic
926055600 2:9772185-9772207 AAGCACAAAGGGAAGGTGGGAGG + Intergenic
926142942 2:10379256-10379278 ATTTACAAGCAGAAAGAGGGAGG - Intronic
926570573 2:14525351-14525373 AAGGAAGAGGAGAAGGAGGGAGG + Intergenic
926724328 2:15985220-15985242 AAGCACTAGGAGAAAGACACGGG - Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
927989092 2:27434951-27434973 AAGCACTAGGAGAAAGAGGTAGG - Intronic
928593064 2:32836908-32836930 AAGCACAAGAAGAGAGAGAAGGG - Intergenic
928746417 2:34421118-34421140 AAGCAGAAGAAGAAAGAGACAGG - Intergenic
928870647 2:35973812-35973834 AAGTAGAAGGAGAAAAAGAGAGG + Intergenic
928916086 2:36472470-36472492 AAGCACAAGGATCAAGGGAGTGG - Intronic
928940954 2:36726876-36726898 AAAGGCAAGGAGAAAGGGGGTGG + Intronic
928986822 2:37190267-37190289 AAGCATAAGAAGAAAGATGTGGG - Intronic
929898422 2:45981460-45981482 AAGCAGAAGGAGAGAGAAGATGG - Intronic
930366577 2:50446601-50446623 AGGAACAAAGAAAAAGAGGGAGG - Intronic
930642007 2:53862896-53862918 AGGGAAAAGGAGAAAGGGGGTGG - Intergenic
931057793 2:58492226-58492248 AAGCACAAAGAGAAATCAGGTGG - Intergenic
931150069 2:59563118-59563140 AAGAAAAAGGTGAAAGAGGTAGG + Intergenic
931255383 2:60567655-60567677 ATGCAAAAGGAAAAAGAGGAGGG + Intergenic
931340777 2:61398605-61398627 AAAGGGAAGGAGAAAGAGGGAGG + Intronic
931477377 2:62603017-62603039 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
931717531 2:65040914-65040936 AGGGACAAGGAAAGAGAGGGTGG - Intergenic
931940455 2:67246287-67246309 AAGGATAGGGAGAAAGAAGGAGG + Intergenic
932149232 2:69354254-69354276 GATCACAGGGAGAAAGAGGTGGG - Exonic
932503321 2:72204303-72204325 AACCTCAAGGAGCCAGAGGGCGG - Intronic
932542260 2:72667427-72667449 AAGCAAAAGGACAAAGCTGGAGG + Intronic
932601840 2:73133062-73133084 AAGAACAAGAAGAAAAAGAGGGG + Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933132220 2:78686128-78686150 GAGCTCAAGGAGTGAGAGGGTGG + Intergenic
933161458 2:79028403-79028425 AAGAAAAAGGAAAAAGAAGGAGG - Exonic
933769098 2:85731938-85731960 AAGCCTAATGAGGAAGAGGGAGG - Intergenic
933810282 2:86028787-86028809 AGACACAAGGAGAGAGAGAGCGG - Intronic
933849239 2:86352429-86352451 CAGCTCCAGGAGACAGAGGGAGG - Intergenic
933982938 2:87568419-87568441 GAGGGAAAGGAGAAAGAGGGAGG - Intergenic
934037460 2:88100060-88100082 GAAAACAAGGAGGAAGAGGGGGG - Intronic
934520868 2:95019369-95019391 AAGGACAGGGAGAAAGGGCGGGG - Intergenic
934535339 2:95128700-95128722 AGGAAGAAGGAGAAAGAAGGAGG + Intronic
935335394 2:102010712-102010734 AAGCAACAGGACAAAGAGGGAGG - Intronic
935444437 2:103141272-103141294 AAACACAATGAAAAAGAAGGAGG + Intergenic
935505603 2:103898374-103898396 AAGTAGAAAGAGAAAGAAGGAGG + Intergenic
935508793 2:103944237-103944259 AAACAGAAGGACAAAGTGGGAGG + Intergenic
936310903 2:111382376-111382398 GAGGGAAAGGAGAAAGAGGGAGG + Intergenic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
937563277 2:123251431-123251453 AAGGAGAAGAAGAAAGATGGCGG + Intergenic
937587895 2:123577296-123577318 AAACACTAGGAGAAATAGAGAGG + Intergenic
937907407 2:127058955-127058977 AAGCCGGAGGAGAAGGAGGGAGG + Intronic
937911517 2:127077921-127077943 AAGCAAAGGGAGAAAAAGGTGGG + Intronic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938926482 2:136047850-136047872 AAGCAGATGGAGAAAGAGGTGGG + Intergenic
939256090 2:139746759-139746781 AAACACCAGGTGGAAGAGGGCGG + Intergenic
939444612 2:142292406-142292428 AAGGAAAAAGAGAGAGAGGGGGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940179739 2:150918672-150918694 AAGGAAAAGGGGAAAGACGGAGG + Intergenic
940584732 2:155632636-155632658 TAGCACAAGGAGAAAGAACCTGG + Intergenic
940768347 2:157814231-157814253 TATCACAAGGATAAAAAGGGGGG + Intronic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941617321 2:167735458-167735480 AAGCACAGGGAGAAATAGATTGG - Intergenic
942305004 2:174598772-174598794 AAGCATAGAGATAAAGAGGGTGG + Intronic
942867828 2:180697873-180697895 AAGCAAGAGGAAAAAGAGGGGGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
944541856 2:200761611-200761633 AAGAATAAGGATGAAGAGGGTGG + Intergenic
944686325 2:202121087-202121109 AAGTCCAAGGAGAACGAGGAGGG - Intronic
944916481 2:204365746-204365768 AAGCAAAAAGAGAAAAAAGGAGG + Intergenic
945621953 2:212150687-212150709 AAGCACAAGAAGAATGAGTCTGG - Intronic
945767220 2:213995952-213995974 AAGGACAAGGAGAAAGAGTGAGG - Intronic
945984808 2:216344978-216345000 AAGCAGAAGGGGAAAGATGTTGG + Intronic
946071492 2:217037955-217037977 AAGATAAAGGAGAAAGTGGGTGG - Intergenic
946098103 2:217292832-217292854 AAGCAAAAACAGAAAGAGGGAGG - Intronic
946410907 2:219514773-219514795 AAACCCAAGGAGAAGGAGGCAGG + Exonic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947311659 2:228809614-228809636 AAGAGCAAGCAGAAACAGGGTGG - Intergenic
947451720 2:230214600-230214622 AAGGACAAGGAGAGCCAGGGAGG - Intronic
947554015 2:231073094-231073116 AAGGAGAAGGAGAGAGATGGGGG + Intronic
947702939 2:232250359-232250381 ACCCACAAGGACAAAGAGAGTGG + Intronic
947875738 2:233467300-233467322 CAGCACAGGGACCAAGAGGGAGG - Intronic
948033136 2:234836088-234836110 GAGAACAAGAGGAAAGAGGGTGG - Intergenic
948738726 2:240028573-240028595 AAGCAGAAGAATAAAGTGGGAGG + Intergenic
949066818 2:241996004-241996026 AAGCACATTGAGAAGGAGGCTGG - Intergenic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1168910652 20:1444150-1444172 GAGAACGAGGGGAAAGAGGGTGG - Intronic
1168944538 20:1741606-1741628 AAAGAAAAAGAGAAAGAGGGAGG - Intergenic
1169325284 20:4670731-4670753 GAGCACAGGGAGAATGGGGGAGG + Intergenic
1169419580 20:5449145-5449167 AAGGAGAAGGGGAAACAGGGAGG - Intergenic
1169558277 20:6770806-6770828 AGGGAAAAGGAGAAAAAGGGAGG + Intronic
1169765567 20:9144645-9144667 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1169913367 20:10665182-10665204 AAGGAAAAAGAGAAAAAGGGAGG + Intronic
1170056782 20:12214174-12214196 AAGCACAAGGAAGAAGAAGGAGG + Intergenic
1170311116 20:14993044-14993066 AAGAGAAGGGAGAAAGAGGGAGG - Intronic
1170327363 20:15171372-15171394 AGACACAAGGAGAAAGGTGGGGG - Intronic
1170402326 20:16001367-16001389 AAGAAAAAAGAGAAAAAGGGAGG + Intronic
1170652511 20:18255881-18255903 AAGAACAAAGAGAAAGTTGGGGG - Intergenic
1170812814 20:19687832-19687854 AATCACAGTGAGACAGAGGGTGG - Intronic
1171069977 20:22059124-22059146 GAGCACAAGGACAAGAAGGGTGG - Intergenic
1171428477 20:25063695-25063717 AAGCACAGGACGAGAGAGGGTGG + Intergenic
1171533059 20:25864696-25864718 GAGCAGAAGGAGCAAGAGGGAGG + Intronic
1171882597 20:30629456-30629478 AAGCCCAAGGTGAAAAGGGGTGG - Intergenic
1172049776 20:32108347-32108369 AGGCACCTGGAGAGAGAGGGAGG - Intergenic
1172771445 20:37384661-37384683 AAGCCCAAGAAGAAGAAGGGCGG + Intronic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173761563 20:45565073-45565095 AGGAAGAAAGAGAAAGAGGGAGG + Intronic
1174662534 20:52226673-52226695 AAGAAGAAGGAGAGAGAAGGTGG - Intergenic
1174666806 20:52265652-52265674 ATTCACAAGGACAAAGAGAGTGG - Intergenic
1175272056 20:57741110-57741132 AAGTATAAGGAGAAAGAAAGTGG + Intergenic
1175342147 20:58239621-58239643 AGGCACGTGCAGAAAGAGGGTGG - Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1176735845 21:10546346-10546368 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1177030489 21:15977434-15977456 ATGCAAAAGCATAAAGAGGGAGG - Intergenic
1177219955 21:18179665-18179687 AAGTACAAGGAAAAGGAGAGTGG - Intronic
1177343332 21:19834643-19834665 AAGAAAAAGGACAAAGAAGGAGG - Intergenic
1177966649 21:27736117-27736139 AGGCAAAAGGAGAGAGAGTGTGG + Intergenic
1178505256 21:33157401-33157423 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505261 21:33157420-33157442 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505266 21:33157439-33157461 AAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1179958225 21:44752688-44752710 AGGGACAAAGGGAAAGAGGGGGG + Intergenic
1180047815 21:45317952-45317974 AATCTCAAGAAGAAACAGGGTGG + Intergenic
1181375580 22:22455208-22455230 AGGCAGAAAGAGAGAGAGGGAGG + Intergenic
1181520328 22:23444838-23444860 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1182053690 22:27332693-27332715 AAGGACAAGGAGGAAGATTGTGG + Intergenic
1182072761 22:27475188-27475210 AAGCTCAGGGAGAAGGAGGCTGG + Intergenic
1182277696 22:29200966-29200988 AAGCAGGAGGAGAATGAGAGTGG - Intergenic
1182728335 22:32467008-32467030 AAGGACAGGGAGAGAGGGGGCGG - Intergenic
1182838039 22:33360491-33360513 GAGCAGCAAGAGAAAGAGGGAGG + Intronic
1183051501 22:35265574-35265596 AAGGACAAAGAGAGAGAGAGAGG + Exonic
1183533306 22:38376524-38376546 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184340260 22:43881945-43881967 AAGCGCAGGGAGGGAGAGGGTGG + Intronic
1184448709 22:44570149-44570171 AAGCAGAAAGAGAAAAGGGGAGG - Intergenic
1184589361 22:45471220-45471242 AAGCACAAGGAAAAAGCAGCTGG - Intergenic
1185015305 22:48339355-48339377 AAACAGCAGGAGAGAGAGGGAGG + Intergenic
1185318524 22:50189657-50189679 AAGGACAGGTAGAAAGGGGGTGG + Intronic
950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG + Intergenic
950665503 3:14492612-14492634 GAGGAAGAGGAGAAAGAGGGAGG - Exonic
951088408 3:18542294-18542316 ATGCTCAAGGAGAAGTAGGGAGG + Intergenic
951162321 3:19439937-19439959 AAACAAAAAGAGACAGAGGGAGG + Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
952045425 3:29313257-29313279 ATGCACAACAAGAAAGAGGTAGG + Intronic
952047105 3:29335871-29335893 AAACAAAATGAAAAAGAGGGAGG - Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952480596 3:33757330-33757352 AAGCAAAAGCAAAAAAAGGGTGG - Intergenic
952602322 3:35100379-35100401 AAGCAATAAGAGAAAGAGGCTGG + Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952907288 3:38149690-38149712 AAGCAGAAGGGGAAAGTGAGAGG + Intergenic
952985870 3:38782458-38782480 AAGAACAAAGAGAAAGAGAATGG - Intronic
953148047 3:40297029-40297051 AAGAACAGGGAGAAAAAGGCAGG - Intergenic
953175416 3:40547241-40547263 AAGAAGAAAGAGAGAGAGGGAGG - Intronic
954382954 3:50229314-50229336 AAGGACAAAGAAAAGGAGGGAGG + Intronic
954781431 3:53064797-53064819 AAGCACGAGGACAAACATGGAGG - Intronic
955109222 3:55931114-55931136 GAGGACATGGAGAAATAGGGAGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955413771 3:58673359-58673381 AAAAATAAGGTGAAAGAGGGAGG - Intergenic
955671808 3:61410270-61410292 AAGGAAAAGGAGAAAGAAGGAGG + Intergenic
955848165 3:63190678-63190700 AGAGAGAAGGAGAAAGAGGGAGG + Intergenic
955964717 3:64377122-64377144 AAGCAGACAGAGAAAGGGGGAGG + Intronic
956077397 3:65520020-65520042 ACCCACAAGGAGAAAAAAGGAGG + Intronic
956166814 3:66403604-66403626 AAGCACCAGGGCACAGAGGGCGG + Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956295941 3:67713785-67713807 GAGCAACAGGAGAGAGAGGGAGG - Intergenic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
956840239 3:73133315-73133337 GAGGAAAAGGAGAAAGAAGGTGG - Intergenic
957363878 3:79196372-79196394 ACGCACCAAGAGAGAGAGGGAGG + Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957832783 3:85544833-85544855 AAAGAAAAGGAGAAAAAGGGAGG + Intronic
958028894 3:88083048-88083070 AAGAAGAGGGAGGAAGAGGGAGG - Intronic
958452568 3:94292522-94292544 AAGAACAAAGAGAAAGTTGGGGG - Intergenic
958623938 3:96601034-96601056 AAGCACAGGGAGAGAGAGAAAGG - Intergenic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959874443 3:111365318-111365340 AAGTAAAAAGAGAAAGAAGGAGG + Intronic
960023871 3:112987194-112987216 AAGTACAAGGACACAGAGGCAGG + Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960597509 3:119419643-119419665 AAGCAGAAGGGGAAAAAGTGTGG + Exonic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960775132 3:121241698-121241720 AAGGAAGAGAAGAAAGAGGGTGG + Intronic
960846590 3:122009613-122009635 AGGGCCAAGGAGAAAGAGGTTGG + Intronic
961631644 3:128304120-128304142 AAACAAAAGGAGAAATAGGGAGG - Intronic
961790088 3:129369370-129369392 AAGCAGAAAGAGAAAGAGTTTGG + Intergenic
961829651 3:129616955-129616977 AAGCCACAGGGGAAAGAGGGTGG - Intergenic
962075459 3:132076976-132076998 AAGCAGGAAGGGAAAGAGGGGGG - Intronic
962336631 3:134537671-134537693 ATGGAAAAGGAGACAGAGGGAGG - Intronic
962370551 3:134817661-134817683 GAGCTCAAAGAGAAAGAGGTTGG - Intronic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
963331223 3:143918449-143918471 AAACTCAAGGAGTTAGAGGGAGG + Intergenic
963559908 3:146851313-146851335 AAGGAAAAGGAGAAAGGAGGAGG + Intergenic
964016122 3:151949104-151949126 AAGCAAAAGGACAAAGTTGGGGG + Intergenic
964509667 3:157437192-157437214 AAGCACTTGAAGAAAGATGGAGG + Intronic
964517673 3:157530542-157530564 ACTCACAAGGAGAGAGAAGGGGG + Intronic
965631871 3:170741238-170741260 AAGGAGGAGGAGAGAGAGGGAGG + Intronic
965710694 3:171553887-171553909 AATCAGAAGGAGACAGAAGGAGG + Intergenic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966319894 3:178690532-178690554 AAGAAGGAAGAGAAAGAGGGAGG + Intronic
966509948 3:180751025-180751047 ATGCACAAGGAGAGAGGGAGAGG - Intronic
966759766 3:183407547-183407569 AAGAAGCAGAAGAAAGAGGGAGG - Intronic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967441997 3:189518999-189519021 ATTCACAAGGAGGAAGAGAGAGG + Intergenic
967607326 3:191462984-191463006 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
967853688 3:194100757-194100779 AATAAAAAGGAGAGAGAGGGAGG + Intergenic
968048725 3:195638902-195638924 CAGCTCCAGGAGAAACAGGGTGG - Intergenic
968098680 3:195950722-195950744 CAGCTCCAGGAGAAACAGGGTGG + Intergenic
968305893 3:197651022-197651044 CAGCTCCAGGAGAAACAGGGTGG + Intergenic
968738021 4:2308750-2308772 AAGAAAAGAGAGAAAGAGGGAGG + Intronic
968938364 4:3625125-3625147 AAGGACAAGGAGAAGCAGTGTGG + Intergenic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
969338697 4:6527408-6527430 GGGCACCAGGAGAAAGAGAGAGG - Intronic
969345086 4:6564918-6564940 AAGGCCAAGAAGGAAGAGGGAGG - Intergenic
969360571 4:6660716-6660738 AAGGAGGAGGAGAAAGAAGGAGG + Intergenic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
971278127 4:25217195-25217217 AGGCAGAAGGAGAGAGAGAGTGG + Intronic
971388166 4:26160692-26160714 GAGTAAAAGGAGAAAGAGTGTGG + Intergenic
971590287 4:28459029-28459051 AAGCAAAGAGAGAAAGAGAGAGG + Intergenic
971662980 4:29444117-29444139 AAGCAAAAAGAGAAAGGGAGAGG - Intergenic
972994171 4:44859501-44859523 AAGAACAAAGAGAAAGTGAGAGG - Intergenic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973881451 4:55275382-55275404 GAGCAGAAGGAGGAAGAGGAGGG + Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
975470687 4:74762624-74762646 AAGGAGAATGAGAAAGAGGGTGG + Intronic
975983644 4:80184469-80184491 AAGCGCAGAGAGAAAGAGAGAGG - Intronic
976697038 4:87927748-87927770 AAGAAAAAAGAGACAGAGGGAGG - Intergenic
977289241 4:95145439-95145461 AAGTTCCAGGAGAAAGAAGGAGG - Intronic
977379922 4:96259417-96259439 ACACACTAGGAAAAAGAGGGTGG + Intergenic
977468114 4:97407379-97407401 AAGCAGTAGGAGAAAGAAGAAGG - Intronic
977840937 4:101703424-101703446 AAGGGCAAGGAAAAAAAGGGAGG - Intronic
977852844 4:101850905-101850927 AAGCAGAGGGAGAGAGATGGGGG - Intronic
977981910 4:103333707-103333729 AAACACAGTGAGAAAGAGTGGGG + Intergenic
977988275 4:103411594-103411616 AAGCACAAAGAGAATGGGAGAGG - Intergenic
978268539 4:106858990-106859012 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978588549 4:110299598-110299620 AAACAAAACGAGAAAGAGGAAGG + Intergenic
978595904 4:110376896-110376918 AAAAAGAAGGAGAAAGAAGGAGG - Intronic
978643563 4:110900903-110900925 AAGCAACAGGAGAAAAAGAGAGG + Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979594997 4:122525224-122525246 AAGCAGAAGGAAAAAGAAAGGGG - Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980425672 4:132624654-132624676 AAGAAGAAGGAAAAAGAAGGAGG - Intergenic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981512287 4:145571023-145571045 AAGCAAAAGGACAAAGCTGGAGG + Intergenic
981575842 4:146204443-146204465 AAAGACAAGGAGAGAGATGGGGG - Intergenic
981791164 4:148538051-148538073 AAGCACCAAGTTAAAGAGGGAGG - Intergenic
981809165 4:148753912-148753934 AAACGGAAGGGGAAAGAGGGTGG - Intergenic
982287744 4:153753049-153753071 AAGTCCAAGGAGAATGAGAGAGG + Intronic
982566418 4:156992507-156992529 AAGCAAAAGGAGCAAGGAGGCGG + Intergenic
982640835 4:157958087-157958109 ATGCAGAAAGAGAAAGTGGGAGG - Intergenic
982731996 4:158965869-158965891 AAGCACTAGGAGATGGTGGGTGG + Intronic
983273655 4:165592059-165592081 ATGAACAAAGAGAAAGAGGGAGG - Intergenic
983975533 4:173929202-173929224 CTGCATAAGGAGAAAGAAGGTGG - Intergenic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984911261 4:184676454-184676476 AAGGGAAAGGAGAGAGAGGGAGG - Intronic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985742922 5:1630237-1630259 CAGCTCCAGGAGAAACAGGGTGG + Intergenic
986556607 5:9016264-9016286 CAGCACAGGGAGAGACAGGGAGG + Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987425056 5:17763575-17763597 CAGCACAAGCACAAAGAGGTGGG - Intergenic
987452596 5:18104892-18104914 AAGAAAAAGGAAAAAAAGGGGGG - Intergenic
988101103 5:26680009-26680031 AAGAAAGAGGAGAAAGAGGGAGG - Intergenic
988718727 5:33854691-33854713 AAGCAGAAAGACAAAAAGGGAGG + Intronic
989409699 5:41104605-41104627 AAGCTCAATGAGAAAGAAAGTGG + Intergenic
989555087 5:42785042-42785064 AAGCAAAAGAACAAAGATGGAGG - Intronic
989654444 5:43731112-43731134 AAGAAGAAGAAGAGAGAGGGAGG - Intergenic
989813257 5:45704098-45704120 AAGAACAAAGATAAAGAGAGGGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990723549 5:58726904-58726926 AAGCACAGGGCTAAAGAGGACGG + Intronic
990735891 5:58861622-58861644 AAACAAAAGGAGAAAGAGCGAGG + Intergenic
991272286 5:64798355-64798377 CAGGACAAGAAGAAAGATGGTGG - Intronic
991437161 5:66608791-66608813 AAGCAGCAGGGGAAAGCGGGGGG + Intronic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
991619876 5:68534362-68534384 GAACACAAAGAGAAAGAGGGTGG - Intergenic
991641460 5:68758429-68758451 AAGCAGAAGGAAAAAGTGAGGGG - Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992303545 5:75410236-75410258 AAACACAAGGAGAAAAAAGCTGG + Intronic
992407470 5:76473444-76473466 AGAGAGAAGGAGAAAGAGGGAGG - Intronic
992838386 5:80662909-80662931 AAGCACAAAGAGAAAATTGGAGG + Intronic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993723140 5:91341458-91341480 AGGCAGAAGTAGAAACAGGGAGG + Intergenic
994672937 5:102784199-102784221 AAGAACAGAGAGAAAGATGGGGG - Intronic
994810273 5:104508590-104508612 AGGGACAAAGAGAAGGAGGGAGG + Intergenic
994956668 5:106541731-106541753 AAGAAGTAGGAGGAAGAGGGAGG - Intergenic
995324501 5:110875214-110875236 AAACACAAAAAGAAAGAGGGAGG - Intergenic
996343751 5:122467583-122467605 AAGAAAAAGAAGAAAGAAGGAGG + Intergenic
996464889 5:123788755-123788777 AAGGACAGGGAGAGAGATGGAGG - Intergenic
996482345 5:123988955-123988977 AAGAGCAAGGAAAAACAGGGTGG - Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996909358 5:128637438-128637460 AGACAGAAAGAGAAAGAGGGAGG + Intronic
996925611 5:128822969-128822991 AAGCCCTAGGAGAGAGATGGAGG + Intronic
997405358 5:133641916-133641938 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
997476380 5:134144882-134144904 AAGCAAAGGGAGAACGATGGTGG - Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
998368588 5:141646810-141646832 AAGGACAAGGACAAAGAGAAAGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998936720 5:147236795-147236817 AATCAGAAAGAGAAAGAGGAAGG - Intronic
998946259 5:147342516-147342538 AGGCAAAAGGAGACAGGGGGTGG + Intronic
999408786 5:151331660-151331682 AAGCACAACCAGAAAGATAGAGG + Intronic
999595535 5:153199863-153199885 AAGAAAAAAGAGAGAGAGGGAGG + Intergenic
999654483 5:153798833-153798855 AAGAACAAGGAGAAATATAGGGG + Intronic
999869134 5:155731096-155731118 AAGAAAAAGGAGAAAGACAGAGG + Intergenic
1000582884 5:163055556-163055578 AAGAACAAGAACAAAAAGGGAGG + Intergenic
1000733090 5:164860874-164860896 AAGCACAGAGAAAAAGAGAGGGG - Intergenic
1001024786 5:168215005-168215027 AAGCACAAAGAGAAATGAGGAGG - Intronic
1001095170 5:168770417-168770439 AAGCTCCAGAAGAAAGAAGGGGG - Intronic
1001681293 5:173558974-173558996 AAATATAAGGAGAAAGTGGGGGG - Intergenic
1002005713 5:176232632-176232654 AAGAACTAGGAAAGAGAGGGTGG + Intergenic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1002220666 5:177677992-177678014 AAGAACTAGGAAAGAGAGGGTGG - Intergenic
1002461334 5:179375446-179375468 AAGCACAAGGAGGGGGAGTGTGG - Intergenic
1002969088 6:1995823-1995845 AAGCAGGACCAGAAAGAGGGAGG - Intronic
1003034161 6:2628517-2628539 TAGCACTAGGAGGAAGAGGTGGG + Intronic
1003425639 6:5996619-5996641 GAGAACCAGGATAAAGAGGGAGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003981999 6:11398500-11398522 AGGCTCAAGGAGAAAGAATGGGG + Intergenic
1004758435 6:18639122-18639144 AAGGACAAGGTGAAACAGGGTGG + Intergenic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005044447 6:21628717-21628739 AAGGACAAGGGGAAGGAGAGTGG + Intergenic
1005047046 6:21652733-21652755 ATGCACATGGAGAAAGACAGAGG + Intergenic
1005246763 6:23895025-23895047 AGGCCCAAGGAGAAAGAGAGGGG - Intergenic
1005479553 6:26242225-26242247 AAGCACAAGGAGAAACACTTTGG - Intergenic
1005665112 6:28044486-28044508 AAAGAAAAAGAGAAAGAGGGAGG + Intergenic
1005857655 6:29874828-29874850 AAGGAAAGGGAGAAAGAAGGAGG - Intergenic
1005865813 6:29935184-29935206 AAGGAAAGGGAGAAAGAAGGAGG - Intergenic
1005914887 6:30343271-30343293 AAGGACAGGGTGGAAGAGGGTGG + Exonic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006256614 6:32837751-32837773 AAGGACAAGGAAGAAGAAGGCGG + Exonic
1006483333 6:34316765-34316787 GAGCACAGTGAGAAAGAGAGGGG + Intronic
1007309007 6:40930338-40930360 CTGCACAAGGGCAAAGAGGGAGG - Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1008178473 6:48298210-48298232 AAGGATAAGGAGAAACAGAGTGG - Intergenic
1008178615 6:48299982-48300004 AAGGATAAGGAGAAACAGAGAGG + Intergenic
1008659036 6:53646597-53646619 AAGAACAAGGAGACCCAGGGAGG + Intergenic
1008766050 6:54916219-54916241 AGGCAGAAAGAGAAAGAGGGAGG - Intronic
1008790486 6:55226191-55226213 AGGGACAAAGAGAAAGTGGGAGG - Intronic
1009306348 6:62094658-62094680 AAGTACTAGGAGAAAGTAGGGGG - Intronic
1009374719 6:62953126-62953148 AGGCAAAAGGAAAATGAGGGAGG + Intergenic
1009388840 6:63121088-63121110 AAGCACATGGAGAGTCAGGGAGG - Intergenic
1010172202 6:72987219-72987241 AAGAACAAGAGGAAAGAGAGTGG + Intronic
1010526643 6:76907758-76907780 AACCATAAAGAGAAAGAGAGAGG - Intergenic
1010714738 6:79215365-79215387 AAGCAAATGGAACAAGAGGGTGG - Intronic
1011484746 6:87829964-87829986 AAGGAGAAGGAGGAAGAAGGAGG - Intergenic
1011544971 6:88473177-88473199 AAGGAGAAGGAGAGAGAGAGAGG - Intergenic
1012320563 6:97839733-97839755 AAGGACAAGATGGAAGAGGGTGG - Intergenic
1012347754 6:98212429-98212451 AATTACAGGGATAAAGAGGGGGG - Intergenic
1012392600 6:98759988-98760010 AAGAAGAGGGAGAAAGATGGAGG - Intergenic
1012494436 6:99818965-99818987 CAGCTCTAGGAGAAAGAGAGAGG - Intergenic
1012912272 6:105131938-105131960 AATGACAAGGAAAAAGAGGCTGG - Intronic
1013172636 6:107650683-107650705 AAGGAGAAGGAGAAAGATGGGGG - Intronic
1013215618 6:108024725-108024747 AAGCACAGTAAGAAAGTGGGTGG + Intergenic
1013312852 6:108913777-108913799 AACCAGAAGGAGAAACAGGGAGG - Intronic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013446928 6:110238918-110238940 AAGGACAATGAGAAAGATTGAGG + Intronic
1014294198 6:119598401-119598423 AGGCACAAGGAGAAGGAGAAGGG + Intergenic
1015312031 6:131776813-131776835 AAGCACAAGGAGAGAGGATGAGG + Intergenic
1015845208 6:137513237-137513259 CAGTTCAAGGAAAAAGAGGGGGG + Intergenic
1016413228 6:143805557-143805579 AACCAGAAGGAGAAAGAGTGAGG - Intronic
1017625310 6:156341674-156341696 ATCCACGGGGAGAAAGAGGGAGG - Intergenic
1018153860 6:160966612-160966634 GATCACAAGGAGAAACAGGAAGG - Intergenic
1018492117 6:164304529-164304551 TAGGACATAGAGAAAGAGGGAGG - Intergenic
1018533429 6:164793289-164793311 AGGCACATGGAGAAAGAGGGAGG + Intergenic
1018569163 6:165188633-165188655 AAGCAACAGGAAAAGGAGGGTGG - Intergenic
1018788266 6:167125680-167125702 CAGAACCAGAAGAAAGAGGGAGG - Intronic
1018868608 6:167764421-167764443 AAACCCAAGGAGGAAGAGTGAGG + Intergenic
1018869534 6:167770493-167770515 AAGGCCAAGGAGAAAGGAGGGGG - Intergenic
1019022886 6:168933175-168933197 CAGCCCACGGAGAGAGAGGGAGG + Intergenic
1019158112 6:170052502-170052524 AGACAGAAGGAGAGAGAGGGAGG - Intergenic
1019230672 6:170559121-170559143 AAGCAGAGGGAGAGAGATGGGGG - Intronic
1019410963 7:906640-906662 AAGGGAAAGGAGAAAGGGGGCGG + Intronic
1019590914 7:1831390-1831412 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1019629192 7:2037771-2037793 AGGCCCAAGGAGAGGGAGGGAGG - Intronic
1019799011 7:3074010-3074032 AAGCAGGAGGAGAAGGAGAGAGG - Intergenic
1019960229 7:4452918-4452940 AAGCTCAAGCAGAGAGAGAGAGG - Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021179248 7:17487114-17487136 AATCACAAGAACAAAGAGAGTGG + Intergenic
1021316003 7:19147708-19147730 AAGAAAAAGGAGTAAGGGGGAGG - Intergenic
1022268647 7:28784462-28784484 AAGCAAAATGAGCAGGAGGGAGG - Intronic
1022810100 7:33860177-33860199 TTGCACATGGAGAAAGAGGTTGG + Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023314394 7:38920429-38920451 AAGCACAATGAAAAGGTGGGAGG - Intronic
1023478425 7:40606165-40606187 AAGAAGAAGGACAAAGAGAGTGG + Intronic
1023604137 7:41912431-41912453 AAGCAGAAGGGGACAGAGAGTGG - Intergenic
1023655928 7:42420831-42420853 GAGAAAGAGGAGAAAGAGGGAGG + Intergenic
1023775733 7:43604878-43604900 AAGCACAGAGAGAGAGAGGGAGG - Intronic
1023879912 7:44312462-44312484 AAGGAGAGGGAGGAAGAGGGAGG + Intronic
1024032258 7:45471412-45471434 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
1024062110 7:45706248-45706270 AAGCAGAAGGACAAAGCTGGAGG + Intronic
1024215300 7:47243396-47243418 AGAGACAAGGAGAAAGAGAGAGG - Intergenic
1024420415 7:49159305-49159327 AAGGAGGAGGAGAAAAAGGGAGG + Intergenic
1024542675 7:50491810-50491832 AAGCTGGAGGGGAAAGAGGGAGG - Intronic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024755922 7:52531234-52531256 AAGCACAAGGTGAGTGAAGGGGG - Intergenic
1024846275 7:53646450-53646472 AAGAAAAAGAAGAAAGATGGTGG - Intergenic
1025481073 7:60983555-60983577 AACTGCAAGGAGAAAGAGGATGG - Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026159082 7:67852903-67852925 AAGAACAAGGAGATAGAGGGGGG + Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026284985 7:68955124-68955146 AAGCAGAAAGAGAAAGAGAGGGG + Intergenic
1026390279 7:69894308-69894330 AAGCACTAGGAGAGAAAGGCAGG - Intronic
1026494169 7:70888276-70888298 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1026494181 7:70888332-70888354 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026955050 7:74371738-74371760 AAGGACAAAGAGGGAGAGGGAGG + Intronic
1027746275 7:82078876-82078898 AAGAGGAAGAAGAAAGAGGGTGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028432175 7:90760189-90760211 AAACCCCAGGAGAAATAGGGGGG + Intronic
1029154773 7:98508443-98508465 AACCACTGGGAGAAAGCGGGTGG + Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029374680 7:100170523-100170545 AAGCAGAGGGAGACAGAGGGAGG + Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1031922700 7:127613401-127613423 AACCACAAGGAGGAAGAGTCTGG - Intronic
1031949362 7:127876117-127876139 AAGGACAAAGAGAAGGAGAGGGG - Intronic
1032435682 7:131898493-131898515 AGGCATATGGAGAAAGAAGGTGG - Intergenic
1032540526 7:132699409-132699431 AAGCACAGTTAGAAAGAGGAAGG + Intronic
1032645473 7:133818973-133818995 AAGTGGGAGGAGAAAGAGGGTGG + Intronic
1032769048 7:135029889-135029911 AAGGAAAGGGAGAAAGATGGGGG + Intronic
1032830311 7:135618149-135618171 AGGTACAAGGAGAAAGAAGATGG + Intronic
1032915824 7:136488687-136488709 AAGCTCTAGGAGAGAGATGGAGG + Intergenic
1033112504 7:138593704-138593726 AAGGAAAAGGAGAGAGAAGGGGG + Intergenic
1033282301 7:140014916-140014938 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1033393851 7:140955462-140955484 AAGAAGAAGGAGAGAGATGGAGG - Intergenic
1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG + Intronic
1034340931 7:150354565-150354587 ATTCACAAGGAGAAAGATGGTGG - Intergenic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034634136 7:152553926-152553948 CTGCACAAGGAGGAAGAGCGTGG - Intergenic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1035206452 7:157296742-157296764 AAACACAAGGTGAAAGTGGTTGG - Intergenic
1035856968 8:2985996-2986018 AAGCGGAAGGGGAGAGAGGGAGG + Intronic
1036460091 8:8944950-8944972 GAGCACAATGAGAGAGAGGTAGG + Intergenic
1036485383 8:9174434-9174456 AGGCACATGGAGAAAGAAAGAGG + Intergenic
1036527756 8:9551081-9551103 AAGTAAAAGGAGATAGTGGGTGG + Intergenic
1036987982 8:13557930-13557952 AAGAACAAGGAGAAGGTTGGAGG + Intergenic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037303718 8:17482421-17482443 AAGGAGAGGGAGAAAGATGGGGG - Intergenic
1037308986 8:17535300-17535322 AAGCTCAGTGAGAAGGAGGGCGG - Intronic
1037608072 8:20454152-20454174 GTGAACAAGGAGACAGAGGGTGG - Intergenic
1037873173 8:22519435-22519457 AATCACAAAGAGAAAAAGAGAGG - Intronic
1038148271 8:24918169-24918191 AAAGAGAAGGAGAAAGCGGGAGG + Exonic
1038489134 8:27957143-27957165 AAGCAAAAAGAGAAAGGGAGTGG - Intronic
1039564173 8:38538078-38538100 AACTACAAGCAGAAAGGGGGAGG - Intergenic
1039659433 8:39446982-39447004 AAACACAGGGTGGAAGAGGGTGG + Intergenic
1041205069 8:55491021-55491043 AAGCACAGAGAGAAAAAGGCTGG - Intronic
1041315724 8:56560185-56560207 GAGAACAAGGAGGGAGAGGGAGG + Intergenic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042409832 8:68451569-68451591 AAGCCCAAGGTGAAGGAGAGAGG + Intronic
1042559285 8:70060768-70060790 AGGCACAAAGAGAAATAGGTCGG - Intronic
1042697360 8:71570126-71570148 AAGCACAAAGAGACAAAGTGTGG + Intronic
1042709514 8:71700670-71700692 AAGCACAGGAAGACAAAGGGAGG - Intergenic
1042839873 8:73112727-73112749 AAAGAGAAAGAGAAAGAGGGAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043222553 8:77685753-77685775 AAGCAAGAAGAGAGAGAGGGTGG - Intergenic
1043250662 8:78069082-78069104 AAGCCCAAAGACAACGAGGGAGG + Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1044824507 8:96183549-96183571 AAGCGCAGGCAGAAAGAGGTGGG + Intergenic
1045828398 8:106428474-106428496 AAGCAAAAGGAGGAAGAGGTTGG + Intronic
1045866978 8:106878529-106878551 AAGCACAAAGAGAAGGTTGGAGG - Intergenic
1045951587 8:107857387-107857409 AAGCAAAATGACAAAGAGAGAGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046761637 8:118027511-118027533 AAGCACTTGTAGAGAGAGGGAGG - Intronic
1048382762 8:133882512-133882534 GAGCACATGGAGAAAAAGAGAGG + Intergenic
1048403759 8:134097269-134097291 AAGAAAAAGGAGAAATAGGGAGG + Intergenic
1048578749 8:135713511-135713533 AAGCACAGAGGGAAGGAGGGAGG + Intergenic
1048844764 8:138595807-138595829 GAGCACAAGGACAAAAGGGGAGG - Intronic
1048872026 8:138807033-138807055 ATGCAGGAGGAGAAATAGGGGGG + Intronic
1049595913 8:143483331-143483353 CAGCACCAGGAGAAACCGGGAGG - Intronic
1050141157 9:2517117-2517139 AAGCAAAAGGACAAAGTTGGAGG - Intergenic
1050901452 9:10953900-10953922 AAGCACAGGGTGAGAGATGGAGG + Intergenic
1051216452 9:14803195-14803217 AAGAGAAAGAAGAAAGAGGGAGG - Intronic
1051338618 9:16090959-16090981 AAGAAAATGAAGAAAGAGGGTGG - Intergenic
1052052082 9:23860082-23860104 AACCAAAAGGAGAAAAAGGCAGG - Intergenic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1052337623 9:27336406-27336428 AGACACCAGGAGAAAGGGGGAGG + Intronic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1052885752 9:33646857-33646879 AACCAGAAAGAGAAAAAGGGAGG + Intergenic
1053016954 9:34667314-34667336 AATGAGAGGGAGAAAGAGGGTGG - Intergenic
1053466813 9:38314616-38314638 AAGAAGGAGGGGAAAGAGGGAGG - Intergenic
1054452851 9:65412685-65412707 AAGGACAAGGAGAAGCAGTGTGG - Intergenic
1054861783 9:69961243-69961265 AAGGACAAAGAGAGAGAGCGAGG - Intergenic
1055166329 9:73199736-73199758 AAGGAGATGGGGAAAGAGGGAGG + Intergenic
1055493904 9:76835354-76835376 AATAACAGAGAGAAAGAGGGAGG + Intronic
1055680486 9:78710256-78710278 AAGAACCAGGAGAAAGAAAGAGG - Intergenic
1056288231 9:85113070-85113092 AGGCTGGAGGAGAAAGAGGGAGG + Intergenic
1056472045 9:86915111-86915133 AAGTAAAAAGAGAAAGAAGGAGG + Intergenic
1056545112 9:87606663-87606685 AGGGACAGGGAGAGAGAGGGAGG - Intronic
1056662340 9:88553464-88553486 AGAGACAAGGAGAAGGAGGGTGG - Intronic
1056828820 9:89897242-89897264 AAGCAGAAGGTGAAAGTTGGTGG + Intergenic
1056850648 9:90081075-90081097 AGGCTGGAGGAGAAAGAGGGAGG - Intergenic
1056963960 9:91150709-91150731 GGCCACAAGGAGAAAGAGAGAGG + Intergenic
1057202874 9:93152251-93152273 AAGTCCAGGGAGAAACAGGGAGG + Intergenic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057949618 9:99359398-99359420 GAGCAGACGGAGAAAGAAGGTGG - Intergenic
1058578247 9:106426186-106426208 AAGGACAAGGTGAAGGGGGGTGG + Intergenic
1058984206 9:110196632-110196654 AAGCCAAAGGGGAAAGAGGGAGG + Intronic
1059588319 9:115630103-115630125 AAGCCTAAGGAAAAGGAGGGAGG + Intergenic
1059779824 9:117514708-117514730 AAGCCCAAGGTGACAGAGTGTGG + Intergenic
1059835358 9:118146202-118146224 AAACACAAGGAGAGAGAGAAAGG - Intergenic
1059947519 9:119426779-119426801 AAGCCCAAAGAGCAAGAGAGAGG - Intergenic
1059998112 9:119933457-119933479 GAGCAAAAGGAGCAAGAGAGAGG - Intergenic
1060415765 9:123429092-123429114 AAGCAAAAGGACAAAGCTGGAGG + Intronic
1060453525 9:123766444-123766466 AAGCTCTAGGAGATAGATGGTGG - Intronic
1061242443 9:129382496-129382518 AGGCACCAGGAGAAGCAGGGAGG - Intergenic
1061630550 9:131869620-131869642 AAGCCCAAGGAAAGGGAGGGAGG + Intronic
1061890475 9:133616694-133616716 GAGCACCAGGAGGAAGAGGAGGG - Intergenic
1061916175 9:133755642-133755664 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638411 9:137503594-137503616 AAGGAGAAGGAGGAAGAAGGAGG + Intronic
1062703966 9:137924360-137924382 AAGGAGGAGGGGAAAGAGGGAGG - Intronic
1185545366 X:939389-939411 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1185603480 X:1354577-1354599 AAGAAAACGGAGAAAGAGGAGGG + Intronic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1185830196 X:3294303-3294325 AAGGAGAAGGAGAAAGAAGGAGG - Intergenic
1186069960 X:5808802-5808824 AAGCAGCAGGAGAGGGAGGGAGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186568599 X:10690985-10691007 AATCACAAGGAGACAGTGGTAGG - Intronic
1186598997 X:11015958-11015980 AGGCAACAAGAGAAAGAGGGTGG + Intergenic
1186615567 X:11183623-11183645 AGGAAAAAGGAGACAGAGGGAGG - Intronic
1187025682 X:15433649-15433671 AAGAGGAAGGAGAAAGAAGGAGG + Intronic
1187158858 X:16745829-16745851 AAGGACAAAGAGAATGAGAGAGG - Intronic
1187459943 X:19477934-19477956 AAGGACAGGGAGAGAGAGAGAGG + Intronic
1187631619 X:21179175-21179197 AAGCATAAGAAGAAATAGGAAGG - Intergenic
1187865038 X:23716178-23716200 GAGCACAGGGAGAAAGAATGTGG + Intronic
1187944390 X:24412158-24412180 AAGCTCAAGGAGAAAGAGCAGGG - Intergenic
1188033208 X:25287805-25287827 AAGAAGAAGGAAAAAGAGAGGGG - Intergenic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188451386 X:30310729-30310751 CAGCAAAAAAAGAAAGAGGGAGG - Intergenic
1188466171 X:30483713-30483735 AAACAGAGAGAGAAAGAGGGTGG + Intergenic
1188609611 X:32079631-32079653 AAGAAAAAAAAGAAAGAGGGAGG + Intronic
1188876855 X:35441060-35441082 AAGGGGAAGGAGAAATAGGGTGG + Intergenic
1189154321 X:38741417-38741439 AAGAAGAAAGAGAGAGAGGGAGG - Intergenic
1189226515 X:39417940-39417962 ACCCACAAGGAGGAAGATGGAGG + Intergenic
1189238665 X:39508458-39508480 AAGCACCAGGAGGAAGTGGGTGG - Intergenic
1189250173 X:39594591-39594613 AAGAACAAAGAAAAAGAGTGAGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190851281 X:54244801-54244823 AAGCTGGAGGGGAAAGAGGGAGG - Intronic
1190937384 X:55008912-55008934 AAACAGAATGAGAAAGAGGAAGG - Exonic
1191025372 X:55908217-55908239 AAGCTCCAGGACAAAGGGGGCGG + Intergenic
1192276326 X:69634793-69634815 AAGCACATGTACAATGAGGGTGG + Intronic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1193940556 X:87676753-87676775 AGGAAAAAGGAGAAAAAGGGGGG + Intergenic
1194029073 X:88789432-88789454 AAGCCCAAGGTGACTGAGGGTGG - Intergenic
1194249801 X:91560960-91560982 AAGCACAAGGACAAACATGGAGG - Intergenic
1194559065 X:95397690-95397712 AAGGAGCAAGAGAAAGAGGGGGG - Intergenic
1194607959 X:96005470-96005492 AAGAACAAAGAAAAACAGGGTGG + Intergenic
1194617987 X:96131045-96131067 AACCACAAGGACAAAGAGAATGG - Intergenic
1194818676 X:98478551-98478573 AATCACTAGGAGATAGATGGTGG - Intergenic
1194849868 X:98857231-98857253 AGGCTAAAGGAGAAAGTGGGAGG - Intergenic
1194935192 X:99939635-99939657 AAGCACAAGGCGATCGAGGCTGG + Intergenic
1195468500 X:105208089-105208111 ATGCACAGGGAAAAACAGGGAGG + Intronic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1196329488 X:114453753-114453775 AAGAACTAGAAGAAGGAGGGAGG + Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1196601297 X:117604452-117604474 GAGCAGAAAGAGAGAGAGGGGGG - Intergenic
1197698488 X:129576709-129576731 AAGCCTAAGGGGAAAGAGGGGGG + Intronic
1197710217 X:129660676-129660698 AGGCAGCAGGAGAAAGAGAGAGG + Intergenic
1198133979 X:133728344-133728366 AAGGAGAAGGAGAAAGGAGGAGG + Intronic
1198854173 X:140998521-140998543 AAGCACAGAGAGAAAGAGTCTGG - Intergenic
1198877835 X:141246592-141246614 AAGCACAGAGAGAAAGAGTCGGG + Intergenic
1199270837 X:145881298-145881320 AAGCAGGAAGAGACAGAGGGAGG + Intergenic
1199717864 X:150519055-150519077 AAGGAGGAGGAGAAAGAAGGAGG + Intergenic
1200179099 X:154139621-154139643 ACGCTCAAGGACACAGAGGGTGG + Intergenic
1200473514 Y:3617442-3617464 AAGCACAATGAAAAAAAGGCAGG - Intergenic
1200568765 Y:4802210-4802232 AAGCACAAGGACAAACATGGAGG - Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1201312742 Y:12611861-12611883 GAGGACGAGCAGAAAGAGGGTGG + Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic