ID: 1158612578

View in Genome Browser
Species Human (GRCh38)
Location 18:58955627-58955649
Sequence GCCATGTTCACAGGCCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158612578_1158612582 26 Left 1158612578 18:58955627-58955649 CCCAAATGGCCTGTGAACATGGC 0: 1
1: 0
2: 0
3: 15
4: 118
Right 1158612582 18:58955676-58955698 AAAGATGTTTTTATTGTATTTGG 0: 1
1: 0
2: 6
3: 88
4: 793

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158612578 Original CRISPR GCCATGTTCACAGGCCATTT GGG (reversed) Intronic
904463667 1:30695161-30695183 GCCATGTTCAGAGCCCTTTCTGG + Intergenic
907817892 1:57938018-57938040 GCCATGTTCAGAGAACATTCTGG + Intronic
910988869 1:93034438-93034460 GCCATCATCACAGTCAATTTGGG + Intergenic
911169227 1:94753822-94753844 GCCCTGCACACAGGCCATTCAGG + Intergenic
913960003 1:143332094-143332116 GCCATGTTAAAAGTGCATTTTGG - Intergenic
917646695 1:177035798-177035820 GCTCTTCTCACAGGCCATTTTGG + Intronic
920253732 1:204640042-204640064 GCCATGGTCTTAGTCCATTTGGG + Intronic
1063827480 10:9913872-9913894 GCCATGTTTTCATGCTATTTGGG - Intergenic
1064435463 10:15307227-15307249 GTCATATACACAGGCCATATGGG + Intronic
1067904756 10:50279167-50279189 TCCATCTTCCTAGGCCATTTTGG - Intergenic
1070388818 10:75951031-75951053 GCCAAGTTCACAGGCGATATTGG - Intronic
1071437630 10:85662016-85662038 GCCATGTTCACAGGGCATCCAGG + Intronic
1072618595 10:97065726-97065748 GCAATGTTCTCAGTCCATTTAGG - Intronic
1076346787 10:129784848-129784870 GCCATGAGCACAGGCAATGTGGG + Intergenic
1076544650 10:131237099-131237121 GACATGTTCACAGGCCAGCAAGG - Intronic
1078142786 11:8703879-8703901 TCCACGTTCACTGACCATTTGGG - Intronic
1079219155 11:18544272-18544294 GCCATGACCACTGGCAATTTTGG + Intronic
1082027114 11:47580664-47580686 ACCATGTTCGCAGGGCATGTGGG + Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1087248481 11:95869401-95869423 ACCATGTCAATAGGCCATTTTGG - Intronic
1087452992 11:98348479-98348501 GCCATGTGAACCAGCCATTTTGG - Intergenic
1089164133 11:116461757-116461779 GCCATTTTCTCAGCCCATTAAGG + Intergenic
1090084008 11:123634789-123634811 CACATGTTTACAGGCTATTTGGG + Intronic
1090280220 11:125449304-125449326 GGCATGATCACAGGTCACTTTGG - Intronic
1090630749 11:128645112-128645134 GACAGTTTCACAGGACATTTGGG - Intergenic
1092594604 12:9987643-9987665 CCCATTTTCACATGACATTTAGG + Intronic
1093773705 12:23047884-23047906 GACATGGTAAAAGGCCATTTAGG + Intergenic
1095879397 12:47116930-47116952 GCCATTGTCACAGTCAATTTGGG + Intronic
1102931063 12:116862627-116862649 GCCATCTTCACAGTCAACTTTGG - Intronic
1103434621 12:120915211-120915233 TCCCTGTCCACTGGCCATTTTGG - Intergenic
1104178955 12:126359475-126359497 GCCATGTACGTAGGCCAGTTGGG - Intergenic
1105801282 13:23904496-23904518 GCCCTGTTCACTTGCCCTTTGGG - Intergenic
1108583449 13:51847184-51847206 GCCATGGTCTCTGGCCTTTTGGG + Intergenic
1111228656 13:85311124-85311146 TCCATGTTGACTGGCCATTGTGG + Intergenic
1118105640 14:62656403-62656425 GCCATCTTCACTGGCCATTCTGG - Intergenic
1121311293 14:92936520-92936542 GCCAAGTCCAGAGGCCAGTTGGG + Intergenic
1121489410 14:94347174-94347196 GCCATGTTCACATGCTGTTTGGG + Intergenic
1121539560 14:94714870-94714892 GCCATGTGCTCAGCTCATTTTGG + Intergenic
1122464183 14:101918864-101918886 CCAATGTCCCCAGGCCATTTGGG - Intronic
1128260820 15:66231684-66231706 GGCAGCTTCACAGGCCCTTTGGG + Intronic
1129045601 15:72731292-72731314 GCCATGTTTTCAGGCCATCTTGG + Exonic
1131191712 15:90322259-90322281 GCCATGTTAACAGGCCAGGCTGG - Intergenic
1131620208 15:94060294-94060316 GCCATATTGAGAGGCTATTTGGG - Intergenic
1132019113 15:98345126-98345148 CCCATGGTCAAAAGCCATTTAGG + Intergenic
1132353389 15:101154499-101154521 CCCATCTTCACAGGCCCTTCTGG + Intergenic
1132477106 16:145551-145573 CCCATATTTACTGGCCATTTCGG - Intergenic
1132688451 16:1171924-1171946 GGCATGTTCACAGGCCAGGCGGG + Intronic
1133212586 16:4271789-4271811 GCCAGGTGGGCAGGCCATTTGGG - Intronic
1144705606 17:17365747-17365769 GCCATGTGCAGAGGACATATGGG - Intergenic
1144753672 17:17667069-17667091 GCCATGGTCACAGGCTCTTGGGG - Intergenic
1147250338 17:39149450-39149472 GCCCTTTTCACAGGCCAGGTGGG - Intronic
1147558415 17:41494519-41494541 GCCATGGTGACAGGCCATCAGGG - Intergenic
1148031256 17:44622718-44622740 CCAATGTTTACAGGCTATTTCGG - Intergenic
1148569399 17:48656168-48656190 CCCTTGTTCTCAAGCCATTTTGG - Intergenic
1150986548 17:70204499-70204521 GCCATTGTCAGAGGCCACTTTGG + Intergenic
1156042055 18:32834111-32834133 ACCATGTTTACACACCATTTGGG + Intergenic
1156234249 18:35185640-35185662 GCCATCTTCACAATCGATTTAGG - Intergenic
1158406347 18:57163161-57163183 GCCATGTGAGCAAGCCATTTTGG + Intergenic
1158612578 18:58955627-58955649 GCCATGTTCACAGGCCATTTGGG - Intronic
1160237277 18:77095858-77095880 GCCATGTGCACGCACCATTTGGG + Intronic
1160616107 18:80130198-80130220 CCCATCCTCACAGGCCCTTTAGG - Intronic
1161367621 19:3889825-3889847 GCCATTTGCACAGCCCATCTCGG - Intronic
1162498293 19:11035617-11035639 GCCAGGTTCAGAGGCCCTTGGGG - Intronic
1163202088 19:15776833-15776855 TCCAGGTTCTCAGGCCGTTTTGG + Intergenic
1163222241 19:15929913-15929935 TCCAGGTTCTCAGGCCTTTTGGG + Intronic
926214438 2:10895477-10895499 GCCATGGCCACTGGGCATTTTGG - Intergenic
926685076 2:15691910-15691932 GCAGTGTCCACAGGCCATGTTGG + Intronic
930034532 2:47077154-47077176 GTCAGTTTCACAGGCCACTTAGG - Intronic
931593981 2:63920345-63920367 GGCATTTTCACTGGCCAATTAGG + Intronic
933870194 2:86558566-86558588 GCCATGGTGACAGGTCAATTCGG - Intronic
935562228 2:104571017-104571039 GCCATGTTGTCATGCCACTTGGG + Intergenic
937162406 2:119777064-119777086 GCCAGGTCCACAGACCATGTAGG - Intronic
937209085 2:120256193-120256215 GCCATGTGAACGTGCCATTTTGG - Intronic
937440273 2:121909211-121909233 CCCAAGTGCACAGGACATTTGGG - Intergenic
937538668 2:122922993-122923015 GCCATGGTAACTGGCAATTTGGG + Intergenic
940892240 2:159046446-159046468 TCAATGATCAGAGGCCATTTGGG - Intronic
942259294 2:174141634-174141656 GCCATGGTGATAGGCTATTTAGG - Intronic
943182895 2:184565988-184566010 TCCATGTTAACAGGCCAATTTGG - Intergenic
945729275 2:213513383-213513405 TGCATGTTCTCAGGCAATTTGGG + Intronic
946573501 2:221049945-221049967 TCAATGTTCACTGGTCATTTTGG + Intergenic
947404407 2:229759857-229759879 ACCATGTCAACAGGACATTTTGG + Intergenic
1179206743 21:39288107-39288129 GCCATGTGAATAAGCCATTTTGG - Intronic
1179937561 21:44614894-44614916 CTCATGTTCCAAGGCCATTTGGG - Intronic
1184340243 22:43881874-43881896 GCCAAGTTCAAAGTCCATTTTGG - Intronic
951030405 3:17875361-17875383 GTCATGGACACAGGCCATTAAGG + Intronic
951731449 3:25814360-25814382 GCCAAGTACACAAGCCTTTTTGG + Intergenic
952976886 3:38704245-38704267 GCCATGAGCAAAGGCCACTTTGG - Intronic
956366622 3:68510269-68510291 GCCAAGTTAACAGGACATTATGG - Intronic
956686874 3:71837547-71837569 ACCATATTCAAAAGCCATTTAGG + Intergenic
957475641 3:80719804-80719826 GCCATTCTCACAGTCCATCTGGG - Intergenic
959751267 3:109838769-109838791 GCTAGGTTCTCAGGCAATTTTGG - Intergenic
960692534 3:120361855-120361877 GCCATGTTCACTGGCCTTTCTGG - Intergenic
961399022 3:126621268-126621290 ACCATGTTTACAGGCCAAGTGGG + Intronic
962499854 3:135980283-135980305 GCCTTGTTCACAGGCAAGATGGG - Intronic
972077787 4:35107861-35107883 TCCAAGATTACAGGCCATTTGGG + Intergenic
985334910 4:188881857-188881879 GCCATTTTCAAAGGGCATTAGGG + Intergenic
987819538 5:22945051-22945073 GTCATGTTCAAAGTCCATTTTGG - Intergenic
988538667 5:32090127-32090149 GCCCAGTTCTCAAGCCATTTTGG + Exonic
992913801 5:81426615-81426637 GCCATGTGCATAGTCCATTAGGG + Intronic
992973452 5:82086495-82086517 GCCATGTAGAGAGGCCATGTAGG - Intronic
995744647 5:115391107-115391129 GCCATGTTCACAGAAAACTTTGG + Intergenic
995889589 5:116935954-116935976 GCCATAATAACAGTCCATTTTGG + Intergenic
998498364 5:142610674-142610696 CCAATGTTCACAGTCCATATTGG + Intronic
1001455388 5:171856187-171856209 GTCTTGTTCAGAGACCATTTTGG - Intergenic
1006062234 6:31432303-31432325 GTCTTCTGCACAGGCCATTTGGG - Intergenic
1006446970 6:34085026-34085048 GCCCTGCTCTCAGGCCCTTTTGG - Intronic
1007602283 6:43090005-43090027 GCCATGTTCAAAGGCCCTTCAGG - Intronic
1015021246 6:128478534-128478556 ACCATAGGCACAGGCCATTTTGG + Intronic
1016471494 6:144379406-144379428 GCCATGTACATAAGCCATCTTGG - Intronic
1017662084 6:156684786-156684808 GCCAAGTGAATAGGCCATTTTGG - Intergenic
1018385613 6:163300320-163300342 GCCATGGTCCTAGGCCCTTTGGG - Intronic
1028597175 7:92557975-92557997 GCCATGGTCACATGCCATGTTGG - Intergenic
1038208917 8:25497155-25497177 TCCATTTTCACAAGCCATTGTGG + Intronic
1041693685 8:60714371-60714393 GCCATGTTGTCAGGCCAGGTGGG - Intronic
1043835367 8:85039155-85039177 GGAATGGTCACAGGCAATTTTGG - Intergenic
1044484411 8:92734329-92734351 GCAAGGTTCAAATGCCATTTGGG - Intergenic
1045054942 8:98360814-98360836 GCTTTGTTAACAGGCCAGTTGGG + Intergenic
1045321543 8:101085565-101085587 GCCATGTGTAGAGGCCATATGGG + Intergenic
1047698381 8:127426449-127426471 TCCATTATCACAGGCCATTGAGG - Intergenic
1047861282 8:128970048-128970070 CCCATGTCCACAGGGCATTCCGG + Intergenic
1052861062 9:33438159-33438181 GCCATCTCCACAGCCCACTTTGG - Intergenic
1053176544 9:35929479-35929501 GCAAAGTTCACAGCCCCTTTGGG + Intergenic
1053292955 9:36894116-36894138 TCCATGTTCACCGGCCAGTTTGG - Intronic
1057168089 9:92943978-92944000 GCCATGGGCTCAGGCCATTTAGG + Intergenic
1057177841 9:93012454-93012476 GCCATGGGCTCAGGCCATTTAGG - Intronic
1057671583 9:97094848-97094870 TCAATGTTCACAGGTAATTTTGG + Intergenic
1060005846 9:119998650-119998672 TCCATGTTCCCAGGAGATTTGGG - Intergenic
1060823380 9:126673913-126673935 GCCAGGTACACAGGCCTGTTTGG + Intronic
1188449745 X:30296156-30296178 GCCTTGTTCATAAGACATTTTGG + Intergenic
1192158766 X:68767344-68767366 GGTTTGTTCACAGACCATTTAGG + Intergenic
1193418857 X:81258802-81258824 GCTATTCTCACAGGACATTTGGG + Intronic
1193679972 X:84506419-84506441 AACATGTTCACAGTGCATTTTGG + Intergenic
1195999171 X:110762608-110762630 TCCATGGTCCCTGGCCATTTGGG + Intronic
1199367061 X:146999722-146999744 CCCATTTTCACAAGACATTTAGG - Intergenic