ID: 1158613169

View in Genome Browser
Species Human (GRCh38)
Location 18:58961867-58961889
Sequence ATCTGTTGCTGGAAGTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158613166_1158613169 2 Left 1158613166 18:58961842-58961864 CCATGCATGAGTGAAATGTCTGC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1158613169 18:58961867-58961889 ATCTGTTGCTGGAAGTATTCAGG 0: 1
1: 0
2: 2
3: 15
4: 160
1158613164_1158613169 17 Left 1158613164 18:58961827-58961849 CCAGACCAGCTGGGGCCATGCAT 0: 1
1: 0
2: 1
3: 15
4: 192
Right 1158613169 18:58961867-58961889 ATCTGTTGCTGGAAGTATTCAGG 0: 1
1: 0
2: 2
3: 15
4: 160
1158613165_1158613169 12 Left 1158613165 18:58961832-58961854 CCAGCTGGGGCCATGCATGAGTG 0: 1
1: 0
2: 1
3: 17
4: 164
Right 1158613169 18:58961867-58961889 ATCTGTTGCTGGAAGTATTCAGG 0: 1
1: 0
2: 2
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158613169 Original CRISPR ATCTGTTGCTGGAAGTATTC AGG Intronic
901027062 1:6284275-6284297 GTCTGTAGCTGGAATTCTTCAGG - Intronic
902991974 1:20194341-20194363 ATCTGTTGGTGCAAATTTTCTGG - Exonic
905592808 1:39179320-39179342 TTCTGTTTCTGGAAGTCTTTGGG + Intronic
910681155 1:89866562-89866584 TTGTGTTTCTGGAAGTGTTCTGG + Intronic
910850850 1:91648640-91648662 ATCTGGTGCTGGAAGTTTACTGG - Intergenic
911947385 1:104129551-104129573 ATCTGTTACTGAAAGAATTTTGG + Intergenic
912640620 1:111342198-111342220 ATCTGTTGCTGGATGAATTGGGG - Intergenic
913717383 1:121550571-121550593 TTCTGTTTCTGTAAGGATTCTGG + Intergenic
915234202 1:154468669-154468691 ATCTGTTGCTGGAACCAGGCTGG + Exonic
916841138 1:168602208-168602230 ATATGTTTGTGGAATTATTCTGG - Intergenic
918301755 1:183210503-183210525 ATCAGTTGCTGGAAGACTTTAGG - Intronic
919010904 1:191961946-191961968 AGCTGTTGCTTGTAGTATTCTGG - Intergenic
919341208 1:196309377-196309399 ATATGTAGCTAGAAGTATTTGGG + Intronic
920271541 1:204768482-204768504 AGCGGATGCTGGAAGAATTCAGG - Intergenic
920291714 1:204928147-204928169 ATCTGTGAGTGGATGTATTCAGG - Intronic
923866554 1:237945815-237945837 AGCTGTTGCTTGCAGTATTCTGG + Intergenic
1063254144 10:4308020-4308042 TTCTGTTGTTGGCAGAATTCAGG + Intergenic
1063589440 10:7381728-7381750 ATATCTTCCTGAAAGTATTCAGG - Intronic
1064651190 10:17511585-17511607 ATCTGTTTCTGGAAGTTGTAGGG + Intergenic
1066237965 10:33505516-33505538 ATCTGGTCCCAGAAGTATTCTGG - Intergenic
1067688111 10:48479861-48479883 AGCTGTTGCTGGAAGGACTTTGG - Intronic
1069645113 10:69990667-69990689 AGCTGTATATGGAAGTATTCAGG + Intergenic
1069770965 10:70899653-70899675 ATCCCTTGGTGGAAGGATTCTGG + Intergenic
1070960744 10:80498578-80498600 AGCTGGTGCTGGAAGTAATTGGG + Intronic
1072096749 10:92189379-92189401 ATTTTTTGCTGGAAGTAGTATGG - Intronic
1078566759 11:12421435-12421457 ATCTGTTGCTGGGATTTTTCTGG - Intronic
1079689594 11:23404308-23404330 ATCTGTTGCTGTGAGTTCTCTGG + Intergenic
1088457170 11:110044784-110044806 ATCTGTTGCTAGAATCATCCCGG - Intergenic
1092182848 12:6457924-6457946 ATCTCTTGGTGGAATTATCCTGG - Intronic
1092489657 12:8933530-8933552 ATTTGTTGCTGATACTATTCTGG + Intronic
1093222670 12:16441971-16441993 ATTTGGTGCTGTCAGTATTCTGG + Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1096700267 12:53378500-53378522 AACTTTTGGTGGAACTATTCTGG + Intergenic
1098913369 12:76233011-76233033 ATCTGTTTCAGAAAGTATTATGG + Intergenic
1098957630 12:76703968-76703990 ATCTGTGGCTGGAATAATTTTGG - Intergenic
1099482502 12:83186553-83186575 TTCTGATGCAGGAAGTTTTCTGG + Intergenic
1103752577 12:123175524-123175546 GCCTCTTGCTGGAAATATTCAGG + Intronic
1104102960 12:125632752-125632774 TTCTGTTGCTAGATGTATTGAGG + Intronic
1105908681 13:24839575-24839597 ATCAGTGGCTGTAAGTATTTGGG - Intronic
1106250581 13:27978921-27978943 AGCTTTTGCAGGAAGTCTTCAGG - Intronic
1106937129 13:34735275-34735297 AACAGTTGCTGTAAGTATTTGGG - Intergenic
1111871314 13:93836028-93836050 GTCTGTTGATGAAAATATTCCGG - Intronic
1116686232 14:48042528-48042550 ATCTGGTGCTTTAAGTACTCAGG - Intergenic
1119293189 14:73512240-73512262 ATGTTTTGCTTGAATTATTCTGG - Intronic
1202828448 14_GL000009v2_random:2005-2027 AGCTGTTGCTTGTAGTGTTCTGG - Intergenic
1125196239 15:37050174-37050196 ATCTGTTTGTGGAAGTATTCTGG - Intronic
1126043909 15:44620224-44620246 AGTTGTTACAGGAAGTATTCTGG + Exonic
1126659404 15:51017345-51017367 ATCTGTTGATGCAAGTCTTCAGG - Intergenic
1127050547 15:55079087-55079109 ATCAGTTGCTGTAGGTATTTGGG - Intergenic
1128423007 15:67512638-67512660 ATATGTTGGGGGAAGTATTGTGG - Intergenic
1137331467 16:47501817-47501839 ATCTGATGTTAGAAGCATTCTGG - Intronic
1145044120 17:19599112-19599134 AGCTGTTGCTTGTAGTACTCTGG - Intergenic
1145113189 17:20183795-20183817 ATCTGTGGTTGGTAGAATTCTGG + Intronic
1149119689 17:53147366-53147388 ATCTGTGGCTGGTGGAATTCAGG + Intergenic
1153067370 18:1061418-1061440 CACTTTTGCTGGTAGTATTCTGG + Intergenic
1156605305 18:38659417-38659439 ATCTAATGCTGGAAGTCCTCAGG + Intergenic
1156618041 18:38811440-38811462 ATGTGTTGAAGGGAGTATTCTGG + Intergenic
1156644851 18:39148640-39148662 ATCTACAGATGGAAGTATTCTGG + Intergenic
1158604436 18:58882802-58882824 ATCTGATGCTGGAATCTTTCAGG - Intronic
1158613169 18:58961867-58961889 ATCTGTTGCTGGAAGTATTCAGG + Intronic
1160927165 19:1552266-1552288 GTCTGGTGCTGCAAGGATTCAGG - Intergenic
1163924263 19:20323996-20324018 AAGTGTTGTTGGAAGTTTTCAGG + Intergenic
1165660559 19:37576854-37576876 AGCTGTTGCTGGTAGTACTCTGG - Intronic
1167060438 19:47141539-47141561 AGCTGTTGCTGGAAGAGTTCGGG + Intronic
1202644250 1_KI270706v1_random:125815-125837 AGCTGTTGCTTGTAGTGTTCTGG + Intergenic
928841278 2:35608209-35608231 ATCTGTTGCTGGCATTCTTTTGG - Intergenic
930492792 2:52097098-52097120 ATCTATTATAGGAAGTATTCTGG - Intergenic
932167958 2:69525479-69525501 GTCTGTAGCTGGTATTATTCTGG + Intronic
933683019 2:85119682-85119704 ATCTGTTAGTGTAAGTGTTCAGG + Intergenic
934506622 2:94899361-94899383 AGCTGTTGCTTGTAGTGTTCTGG + Intergenic
937160051 2:119751922-119751944 ATCTATTGCTGAAAATAATCTGG + Intergenic
939509765 2:143091007-143091029 ACCTGTTGCTTGTAGTATTCTGG + Intergenic
940451953 2:153849789-153849811 ATGTGTTCCTTTAAGTATTCAGG + Intergenic
941341674 2:164313270-164313292 TTCTGTTTCTGCAAATATTCAGG - Intergenic
942789209 2:179739418-179739440 AGCTGTTGCTTGTAGTACTCTGG + Intronic
943933233 2:193882343-193882365 ACCTGTTGCAGGAAGTATATAGG + Intergenic
944591638 2:201223214-201223236 GTCTGTAGCTGGAGGTCTTCAGG + Intronic
945594597 2:211776041-211776063 AGCTGTTGCTTGTAGTAGTCTGG + Intronic
946554099 2:220835786-220835808 ATCTGGTACTGTAAGTATTCTGG + Intergenic
948195290 2:236091160-236091182 ATCTGTTTTTGGAAGTACACTGG - Intronic
1170476441 20:16719498-16719520 CTCTGTTACTGGAGGTGTTCAGG - Intergenic
1170556423 20:17518650-17518672 TTCTGTTGCTGGAAAGATTCAGG - Intronic
1170897648 20:20430434-20430456 ACCTGTTGGAGGAAGCATTCAGG - Intronic
1171295310 20:24012109-24012131 ATTTTTGGCTGGAGGTATTCAGG + Intergenic
1171884003 20:30638716-30638738 TTCTGCTTCTGGAAGGATTCAGG + Intergenic
1171894218 20:30744754-30744776 AGCTGTTGCTTGTAGTGTTCTGG + Intergenic
1174232995 20:49061837-49061859 TTCTGTTGCTTTATGTATTCAGG + Intronic
1176317378 21:5259291-5259313 ATCTGTTACTGATAGTATTTAGG + Intergenic
1176607630 21:8846833-8846855 AGCTGTTGCTTGTAGTGTTCTGG - Intergenic
1177257404 21:18683319-18683341 TTCTGTTGCTTAAACTATTCAGG - Intergenic
1178586844 21:33877949-33877971 TTCTGTTGCTGGAAGTAGAGTGG - Intronic
1179221406 21:39410968-39410990 ATCTGTTGCTGGGAGATTTTGGG + Intronic
1179246446 21:39637944-39637966 TTCTGTGGCTGGATGTTTTCTGG + Intronic
1180357716 22:11856624-11856646 AGCTGTTGCTTGTAGTGTTCTGG - Intergenic
1180380549 22:12135709-12135731 AGCTGTTGCTTGTAGTGTTCTGG + Intergenic
950293740 3:11809615-11809637 ATCTGTTGCTGTAAGGTTTTGGG + Exonic
950350029 3:12340808-12340830 ATCTGTTGGTGGAAATCATCGGG + Intronic
951911234 3:27752759-27752781 ATTTGTTTCTGGAAGCATTCAGG - Intergenic
953670678 3:44959369-44959391 TTCTCTGGCTGGAGGTATTCTGG + Exonic
953727978 3:45417357-45417379 ATCTTTTGCTGGATGTTTTCAGG - Intronic
953766917 3:45750091-45750113 AGCTGTTGCTGGAGGGAGTCAGG + Intergenic
954353003 3:50060945-50060967 ATCTGTTGCAGAAATGATTCTGG + Exonic
959318301 3:104837809-104837831 ATCAGTTACTGCAACTATTCAGG + Intergenic
959446700 3:106449246-106449268 ATCTGTTGCCTGAAATATTGAGG + Intergenic
959560849 3:107778976-107778998 ATATGTTGCTGGAGGATTTCAGG - Intronic
961533498 3:127554935-127554957 CTCTGTGGCTGGAAGCATTTTGG - Intergenic
962379313 3:134884305-134884327 ATGTACTGCTGGAAGAATTCTGG + Intronic
962547930 3:136456143-136456165 ATCTGTTGCTGGACCTCTGCTGG - Intronic
962701775 3:138007781-138007803 AACTGTTGTTGGAATAATTCAGG - Intronic
963557050 3:146805376-146805398 ATCTGTCTCTGGAAATATTTTGG + Intergenic
967136078 3:186513805-186513827 ATCTGTAGCTGAAAATATTTTGG + Intergenic
970962066 4:21883941-21883963 TTCTGTTGTTAGAAATATTCGGG + Intronic
973070444 4:45851679-45851701 ATCAGTTGGTGTAAGTATTTGGG + Intergenic
973648886 4:52977628-52977650 ATCTGTGGCAGACAGTATTCAGG + Intronic
973694315 4:53475067-53475089 TACTTTTGCTGGAAGTAGTCTGG - Intronic
974815802 4:67001932-67001954 ATCAGTGGCTGTAAGTATTTGGG + Intergenic
975053026 4:69889996-69890018 ATTTGTTGTTGGAATTATTTTGG - Intergenic
979077947 4:116298302-116298324 AGCTGTTGCTTGTAGTACTCTGG - Intergenic
979903420 4:126253169-126253191 AGCATTTGCTGAAAGTATTCTGG - Intergenic
981926646 4:150147718-150147740 AACTGATGCTGGAAGTATGCAGG + Intronic
986113096 5:4739713-4739735 AGCTGATGATGTAAGTATTCAGG - Intergenic
986654533 5:9998406-9998428 ATCTGTTGCTGTGAGTTTTTTGG - Intergenic
987416965 5:17671739-17671761 CTCTGTTGCAGGCAGAATTCTGG - Intergenic
987757574 5:22116326-22116348 ATTGGTTGTTGGAAGAATTCAGG - Intronic
988810115 5:34776680-34776702 ATCTGTAGTTGCAACTATTCGGG + Intronic
989234578 5:39131417-39131439 ATCTGTTGCTGGCAGAAAACTGG - Intronic
989961176 5:50417213-50417235 TTCTGTTTCTGTAAGGATTCTGG - Intronic
990097001 5:52128501-52128523 ATTTGTTGCTGTCAGTATTTTGG - Intergenic
990241336 5:53819460-53819482 CTCTGTCTCTGGAAGTTTTCTGG - Intergenic
992987723 5:82250787-82250809 AACTATAGCTAGAAGTATTCTGG + Intronic
996382511 5:122876771-122876793 ATCTCTTGCAGGAGGTCTTCCGG - Intronic
1000943079 5:167386809-167386831 ATCAGTTCCTGCAAGTATTTGGG + Intronic
1002567169 5:180118697-180118719 ATCTGGTGCTGGAAGGAGACAGG + Exonic
1002588255 5:180267166-180267188 ATCTGTGGGTGGCGGTATTCAGG + Intronic
1005182172 6:23118384-23118406 ATTTCTTGCTGCAAGTAATCTGG + Intergenic
1007688954 6:43685667-43685689 TTCTCTTGCTGAAAATATTCAGG - Intronic
1008190601 6:48452336-48452358 ATCAGTTGTTGTAAGTATTTGGG - Intergenic
1011319593 6:86076117-86076139 ATCAGTTGGTGTAAGTATTTGGG + Intergenic
1014053484 6:116985017-116985039 TTCTGTGAGTGGAAGTATTCAGG - Intergenic
1021142444 7:17044383-17044405 ATTTGCTGCTGGAAGTAACCAGG + Intergenic
1023335330 7:39163398-39163420 ATCTGTAGTGGGAAGTGTTCTGG + Intronic
1023920618 7:44626756-44626778 TTCTGTTGCTGGGAGTCTCCAGG + Intronic
1024423089 7:49192917-49192939 ACCTGTTGCTTGAAGTCTCCTGG - Intergenic
1025623321 7:63194704-63194726 ATTTCCTGCTGGAAGTATTGTGG + Intergenic
1030064738 7:105651017-105651039 TTCTGTTGCTGGATGCATTACGG + Intronic
1030180104 7:106697966-106697988 ATTTGGTGGTGTAAGTATTCTGG + Intergenic
1030549597 7:110941222-110941244 TTCTGTTGATGGCAGTATTATGG + Intronic
1030888563 7:114969281-114969303 AACTGTTGCTTGATTTATTCAGG + Intronic
1033255876 7:139801003-139801025 AACTGTTTCTGAAATTATTCTGG - Intronic
1033841022 7:145373159-145373181 CTCTGTTGCTGGAAGAAATATGG - Intergenic
1036456621 8:8914829-8914851 TTCTGCTGCTGGAAATATTAAGG + Intergenic
1037998131 8:23368230-23368252 GCCGGTTGCTGGAAGTACTCGGG + Exonic
1040376536 8:46830557-46830579 AGCTGTTGCTGGTAGTATTCTGG + Intergenic
1040442435 8:47457891-47457913 ATCAGTGGCTGTAAGTATTTGGG + Intronic
1040766755 8:50920493-50920515 ATCTGGTCCTGGACGTTTTCTGG - Intergenic
1042751952 8:72167295-72167317 ATCTGGTCCTGGACTTATTCTGG + Intergenic
1045318362 8:101062765-101062787 AACTGTTGCTGAAAGTTTTTGGG - Intergenic
1046479550 8:114797811-114797833 ATCTGTAGCATTAAGTATTCTGG - Intergenic
1048153671 8:131919906-131919928 ATCTGATACTGGAAGCTTTCAGG - Intronic
1050031223 9:1388269-1388291 ATGTGTGGCTGGAAGAATGCTGG + Intergenic
1050424071 9:5496017-5496039 AACTGTTGCCAGTAGTATTCTGG + Intergenic
1051101913 9:13531590-13531612 ATGTGTTGTTTGAAGAATTCCGG + Intergenic
1054354432 9:64048019-64048041 AGCTGTTGCTTGTAGTGTTCTGG - Intergenic
1056836824 9:89962283-89962305 AGCTGTTGCTGGGAGTTTACTGG + Intergenic
1203742767 Un_GL000218v1:17146-17168 AGCTGTTGCTTGTAGTGTTCTGG - Intergenic
1203415642 Un_KI270582v1:4339-4361 ATCTGTTACTGATAGTATTTAGG + Intergenic
1203702970 Un_KI270742v1:11721-11743 AGCTGTTGCTTGTAGTGTTCTGG - Intergenic
1203567329 Un_KI270744v1:102286-102308 AGCTGTTGCTTGTAGTGTTCTGG + Intergenic
1185514418 X:688432-688454 TTCTGTTGCTGGAAGAACTGTGG + Intergenic
1190431864 X:50385754-50385776 ATCTGTTTCTCAAAGTATTGTGG + Intronic
1192774506 X:74228360-74228382 TTCTGTTTTTGTAAGTATTCAGG - Intergenic
1192944910 X:75956209-75956231 TTCTATTGCTGAAAGTTTTCAGG + Intergenic
1196389124 X:115190650-115190672 AACTGTTGCTGGAACTGTTGCGG - Exonic
1198211252 X:134518502-134518524 TTCTTTTTATGGAAGTATTCTGG + Intronic
1198434319 X:136600706-136600728 ATCAGTTTCTGGAAGTCTTGAGG - Intergenic
1198453943 X:136796811-136796833 CTGTGTTGATGGCAGTATTCTGG + Intergenic
1200895080 Y:8367159-8367181 AGCTGTTGCTTGTAGTATTCTGG - Intergenic
1201156304 Y:11134617-11134639 AGCTGTTGCTTGTAGTGTTCTGG - Intergenic