ID: 1158615293

View in Genome Browser
Species Human (GRCh38)
Location 18:58981527-58981549
Sequence CCTTGATGCCATGCATCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 3, 2: 0, 3: 9, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158615293_1158615299 19 Left 1158615293 18:58981527-58981549 CCAGCTGATGCATGGCATCAAGG 0: 1
1: 3
2: 0
3: 9
4: 92
Right 1158615299 18:58981569-58981591 GACAGATGCCACCAATGAGGAGG 0: 2
1: 2
2: 3
3: 20
4: 183
1158615293_1158615298 16 Left 1158615293 18:58981527-58981549 CCAGCTGATGCATGGCATCAAGG 0: 1
1: 3
2: 0
3: 9
4: 92
Right 1158615298 18:58981566-58981588 AATGACAGATGCCACCAATGAGG 0: 2
1: 2
2: 4
3: 18
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158615293 Original CRISPR CCTTGATGCCATGCATCAGC TGG (reversed) Exonic
903172811 1:21564186-21564208 CCCTGATGTTATGCATGAGCTGG - Exonic
904627080 1:31812824-31812846 CCTTGCTCCCATTCACCAGCTGG + Intronic
907411821 1:54288561-54288583 TTTTGATCCCATACATCAGCAGG + Intronic
907608403 1:55842760-55842782 CCTTGAGGCTCTGCATGAGCAGG + Intergenic
910910805 1:92231992-92232014 CCTTCATTCCAGACATCAGCTGG - Intronic
918990359 1:191691174-191691196 ACTTTAAGCCAAGCATCAGCAGG - Intergenic
919305339 1:195826423-195826445 CCTTGATAACAAGCATCAACTGG - Intergenic
1070441221 10:76445446-76445468 CCGTGATGCCCTGCATCTGCAGG - Intronic
1070582649 10:77734189-77734211 CCTTGAGGCTGTGCATCAGCTGG - Intergenic
1072514464 10:96165701-96165723 CCTTTATGCTATGGAACAGCTGG - Intronic
1077910776 11:6570075-6570097 CCGTGCTGCCATGCAAGAGCTGG + Exonic
1078452766 11:11452757-11452779 CCTAGATGCCAGACATCAGAGGG - Intronic
1079330733 11:19530541-19530563 ACGTGATACCATCCATCAGCAGG - Intronic
1079520443 11:21320110-21320132 CCTTGCTGCCATGTTTCAGTGGG + Intronic
1079612534 11:22451075-22451097 CCATGAGGCAATGCAGCAGCAGG + Intergenic
1080461356 11:32457731-32457753 CCTAGATGCAATTCATCAGCAGG - Intergenic
1085019109 11:73193952-73193974 CCATGATGCCAAGCCTCACCAGG - Intergenic
1086972021 11:93091807-93091829 ACTTGATACCATGAAGCAGCTGG + Intergenic
1090670112 11:128940093-128940115 CCTGGATGCCAAGCATGAGAGGG + Intronic
1097130272 12:56806358-56806380 CCTTGATGCCCAGAATCACCTGG + Intergenic
1103006012 12:117420915-117420937 CCTTGGTGCCATGCAGCCTCTGG + Intronic
1104082881 12:125446198-125446220 CTGTGAGGCCAAGCATCAGCTGG - Intronic
1105670185 13:22604919-22604941 CCTATATGCCATGAATGAGCAGG + Intergenic
1110907157 13:80905856-80905878 CCTTGATGCCAGCCATCTGGTGG - Intergenic
1112540498 13:100306876-100306898 CGTCCATGCCATGCTTCAGCTGG + Intronic
1116206091 14:41868572-41868594 CATTCATACCATGCATCAGTAGG - Intronic
1116796879 14:49400858-49400880 CCCTTCTGCCATGCATCACCTGG + Intergenic
1117635169 14:57735488-57735510 AGTTGATGCCAGCCATCAGCTGG + Intronic
1120571020 14:86116595-86116617 CTCTGATGCCATGCTTCTGCAGG - Intergenic
1121830580 14:97048192-97048214 GCTTGAGGCCATGCAAAAGCAGG - Intergenic
1123482607 15:20646702-20646724 TCTGGATGCCATGCATCTGTGGG + Intergenic
1125289690 15:38131984-38132006 CCTTTATGCCATGCATATGTTGG + Intergenic
1127654976 15:61047165-61047187 CTTTGATGCCATGGATGAGTGGG + Intronic
1132318104 15:100905000-100905022 CCTGGGTGCCATGTATCACCTGG - Intronic
1133908702 16:10045155-10045177 CCTTGGTGCCTTCCATCACCAGG + Intronic
1134875854 16:17697953-17697975 CCTTGATGTCATCCATGTGCAGG + Intergenic
1137345026 16:47649183-47649205 CCTTTATGTCATCTATCAGCAGG - Exonic
1144672481 17:17140796-17140818 CCTTGCTGCCAGTCACCAGCAGG - Intronic
1147832924 17:43309794-43309816 CCTTGGTGTCATCCATCACCTGG + Intergenic
1150626918 17:66847875-66847897 CCTTGGTGCTGTGCATCTGCTGG - Intronic
1153401947 18:4691299-4691321 CATTGATAGCATGCATCAGATGG + Intergenic
1156229153 18:35137232-35137254 CTGTGATGTCATGCATCTGCAGG - Intronic
1157587438 18:48813678-48813700 TCTTGATGCCATGGATGATCAGG + Intronic
1158332437 18:56377384-56377406 CCTTGCTGCTTTGCATTAGCAGG - Intergenic
1158615293 18:58981527-58981549 CCTTGATGCCATGCATCAGCTGG - Exonic
1162123866 19:8488788-8488810 GCTTCATGCCATTCATCATCCGG - Exonic
1162185374 19:8900691-8900713 CTTTGATGCCATGGGTCAGCTGG + Exonic
1162185799 19:8903901-8903923 CTTTGATGCCATTGGTCAGCTGG + Exonic
1162186173 19:8906715-8906737 CTTTGATGCCATTGGTCAGCTGG + Exonic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166942000 19:46372997-46373019 ACTTAATGCCAGGCAGCAGCAGG - Intronic
928636941 2:33256383-33256405 CCAAAATGCCATGTATCAGCTGG - Intronic
933742038 2:85541114-85541136 CCTTGATGCCCACCTTCAGCAGG + Exonic
933874989 2:86611091-86611113 ACTTGAGCCCATCCATCAGCTGG + Intronic
935547529 2:104416841-104416863 CTTTGCTTCCATACATCAGCAGG + Intergenic
936149867 2:110010208-110010230 CCTTGATGCCATGCGTCAGCTGG - Intergenic
936194810 2:110361161-110361183 CCTTGATGCCATGCGTCAGCTGG + Intergenic
936935225 2:117833454-117833476 ACTTGCTGCCATACAGCAGCAGG + Intergenic
937684659 2:124682067-124682089 CCTTGAGGCCCTGCACAAGCAGG - Intronic
942485538 2:176435949-176435971 TCTTGATGGCATGCAACAGCTGG + Intergenic
943933256 2:193882509-193882531 GCTTGATTCCATCCATCATCAGG - Intergenic
1170017634 20:11799554-11799576 CCTTGAAGTCATGCATAAGCAGG + Intergenic
1172530347 20:35626656-35626678 CTTTGAGGCCATGGAGCAGCTGG - Exonic
1179181755 21:39051291-39051313 CCATGATGACAGGCATCAGAAGG + Intergenic
1180582881 22:16858177-16858199 CTTTGATGCCATGCATCAGCTGG + Intergenic
1181891669 22:26068811-26068833 CATTGGGGCCATTCATCAGCAGG + Intergenic
1184068067 22:42131313-42131335 CCATGATGCCACTCATCATCAGG - Intergenic
1184070802 22:42144986-42145008 CCATGATGCCACTCATCATCAGG - Intergenic
949599360 3:5581427-5581449 CATGGATGCCATCCAGCAGCTGG - Intergenic
950191162 3:10977156-10977178 CCTTGAGCCCAGGCATCAGCAGG - Intergenic
956797945 3:72732960-72732982 CCTTGGTGCCAAGTATCAGCAGG - Intergenic
958500115 3:94894899-94894921 CCTTTATGCCATGCATTAAAAGG + Intergenic
967091903 3:186141871-186141893 CCTTGTTCCCAGGCACCAGCTGG - Intronic
978173738 4:105705089-105705111 CCTTCAGGCCATGCAGCAGGAGG + Intronic
981046010 4:140266006-140266028 CCTTGAGACCATGGTTCAGCTGG - Intronic
984872769 4:184341889-184341911 CCTGAATGCAATGCATGAGCAGG - Intergenic
998399573 5:141841593-141841615 CCCTGCTGCCCTGCATCTGCTGG + Intergenic
1000706182 5:164515047-164515069 CCTTGATGCCTTTCAAAAGCAGG + Intergenic
1006338897 6:33435155-33435177 CCTTAAAGCTTTGCATCAGCCGG - Exonic
1010407368 6:75520322-75520344 CATTTATGCTGTGCATCAGCTGG + Intergenic
1011690497 6:89863059-89863081 AGTTGATGCCATGCATCAGTGGG + Exonic
1027153590 7:75750577-75750599 ACTTGATCCCATCCATCACCTGG - Intergenic
1028839037 7:95406788-95406810 CCATGATTACATGCAGCAGCAGG - Intronic
1032435614 7:131897944-131897966 CCATGAAGACATGGATCAGCTGG - Intergenic
1032487161 7:132296690-132296712 CCTTGGTGGCATGAATCATCTGG - Intronic
1032794377 7:135265997-135266019 CCTTGATTTCAGGCATCTGCTGG - Intergenic
1035613164 8:982276-982298 CCTTGGAACCATGCCTCAGCAGG + Intergenic
1037910755 8:22742326-22742348 CCTCGATGGCCTGCACCAGCGGG + Intronic
1040748776 8:50679991-50680013 TCTTGATTCCATGCAACAGAAGG - Intronic
1041461313 8:58114907-58114929 CCTTGCTGCCCTTCATCAGAGGG - Intronic
1043979021 8:86616743-86616765 CATTAATGCCAGGCATCAGTGGG - Intronic
1049105266 8:140608792-140608814 CCTTGCTGCCCTGGAGCAGCTGG - Intronic
1052331208 9:27270414-27270436 CCTTGAGGCCCTGCACAAGCAGG + Intergenic
1052400289 9:27991512-27991534 CCTTGACGCCTAGCATCTGCCGG - Intronic
1056685094 9:88752567-88752589 CTTTGATGTCATGCCTGAGCAGG - Intergenic
1056834664 9:89944708-89944730 CCTGGCTCCCATGCCTCAGCTGG - Intergenic
1058835452 9:108855570-108855592 CCACGATGCCGTGCTTCAGCGGG + Exonic
1060833289 9:126733603-126733625 CCTTGAAGCTCTGCGTCAGCAGG + Intergenic
1192266217 X:69539649-69539671 GCTTGATGACATGCATGACCAGG + Intergenic
1192503928 X:71669694-71669716 CCCAGATGCCATGCATCCTCCGG + Intergenic
1194332716 X:92602663-92602685 CTCTGATGTCATGCATCAGAGGG - Intronic
1196095385 X:111792770-111792792 CCTTCATGCCAAGGACCAGCAGG + Intronic
1197730281 X:129803928-129803950 CATTCATACCATGCACCAGCTGG - Exonic
1199038940 X:143087177-143087199 CCTTGCTTTCCTGCATCAGCTGG - Intergenic
1200641411 Y:5721707-5721729 CTCTGATGTCATGCATCAGAGGG - Intronic