ID: 1158616046

View in Genome Browser
Species Human (GRCh38)
Location 18:58987932-58987954
Sequence AAGCCTACTCCCACCACCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158616046_1158616049 -8 Left 1158616046 18:58987932-58987954 CCTAGGGTGGTGGGAGTAGGCTT No data
Right 1158616049 18:58987947-58987969 GTAGGCTTGGAAAGAGGCTTCGG No data
1158616046_1158616050 26 Left 1158616046 18:58987932-58987954 CCTAGGGTGGTGGGAGTAGGCTT No data
Right 1158616050 18:58987981-58988003 ATTTCAGAAACAGTTTCCAGAGG No data
1158616046_1158616051 27 Left 1158616046 18:58987932-58987954 CCTAGGGTGGTGGGAGTAGGCTT No data
Right 1158616051 18:58987982-58988004 TTTCAGAAACAGTTTCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158616046 Original CRISPR AAGCCTACTCCCACCACCCT AGG (reversed) Intergenic
No off target data available for this crispr