ID: 1158616600

View in Genome Browser
Species Human (GRCh38)
Location 18:58993466-58993488
Sequence ATACAGACTTCCCTTGGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158616596_1158616600 23 Left 1158616596 18:58993420-58993442 CCCGGGAATAAATCCAAGTTTCA No data
Right 1158616600 18:58993466-58993488 ATACAGACTTCCCTTGGTATTGG No data
1158616597_1158616600 22 Left 1158616597 18:58993421-58993443 CCGGGAATAAATCCAAGTTTCAG No data
Right 1158616600 18:58993466-58993488 ATACAGACTTCCCTTGGTATTGG No data
1158616598_1158616600 10 Left 1158616598 18:58993433-58993455 CCAAGTTTCAGAGATTTTTCTGT No data
Right 1158616600 18:58993466-58993488 ATACAGACTTCCCTTGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158616600 Original CRISPR ATACAGACTTCCCTTGGTAT TGG Intergenic
No off target data available for this crispr