ID: 1158622147

View in Genome Browser
Species Human (GRCh38)
Location 18:59042213-59042235
Sequence GAGAGGGCAACGAGAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158622147_1158622149 -7 Left 1158622147 18:59042213-59042235 CCAGTCTTTCTCGTTGCCCTCTC No data
Right 1158622149 18:59042229-59042251 CCCTCTCTTGATGAACTTGCAGG No data
1158622147_1158622155 25 Left 1158622147 18:59042213-59042235 CCAGTCTTTCTCGTTGCCCTCTC No data
Right 1158622155 18:59042261-59042283 GCATGCCCACACACACAGCGAGG No data
1158622147_1158622152 -2 Left 1158622147 18:59042213-59042235 CCAGTCTTTCTCGTTGCCCTCTC No data
Right 1158622152 18:59042234-59042256 TCTTGATGAACTTGCAGGCCGGG No data
1158622147_1158622153 1 Left 1158622147 18:59042213-59042235 CCAGTCTTTCTCGTTGCCCTCTC No data
Right 1158622153 18:59042237-59042259 TGATGAACTTGCAGGCCGGGAGG No data
1158622147_1158622151 -3 Left 1158622147 18:59042213-59042235 CCAGTCTTTCTCGTTGCCCTCTC No data
Right 1158622151 18:59042233-59042255 CTCTTGATGAACTTGCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158622147 Original CRISPR GAGAGGGCAACGAGAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr