ID: 1158622148

View in Genome Browser
Species Human (GRCh38)
Location 18:59042229-59042251
Sequence CCTGCAAGTTCATCAAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158622148_1158622155 9 Left 1158622148 18:59042229-59042251 CCCTCTCTTGATGAACTTGCAGG No data
Right 1158622155 18:59042261-59042283 GCATGCCCACACACACAGCGAGG No data
1158622148_1158622158 15 Left 1158622148 18:59042229-59042251 CCCTCTCTTGATGAACTTGCAGG No data
Right 1158622158 18:59042267-59042289 CCACACACACAGCGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158622148 Original CRISPR CCTGCAAGTTCATCAAGAGA GGG (reversed) Intergenic
No off target data available for this crispr