ID: 1158622150

View in Genome Browser
Species Human (GRCh38)
Location 18:59042230-59042252
Sequence GCCTGCAAGTTCATCAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158622150_1158622155 8 Left 1158622150 18:59042230-59042252 CCTCTCTTGATGAACTTGCAGGC No data
Right 1158622155 18:59042261-59042283 GCATGCCCACACACACAGCGAGG No data
1158622150_1158622158 14 Left 1158622150 18:59042230-59042252 CCTCTCTTGATGAACTTGCAGGC No data
Right 1158622158 18:59042267-59042289 CCACACACACAGCGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158622150 Original CRISPR GCCTGCAAGTTCATCAAGAG AGG (reversed) Intergenic
No off target data available for this crispr