ID: 1158622155

View in Genome Browser
Species Human (GRCh38)
Location 18:59042261-59042283
Sequence GCATGCCCACACACACAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158622147_1158622155 25 Left 1158622147 18:59042213-59042235 CCAGTCTTTCTCGTTGCCCTCTC No data
Right 1158622155 18:59042261-59042283 GCATGCCCACACACACAGCGAGG No data
1158622146_1158622155 29 Left 1158622146 18:59042209-59042231 CCTGCCAGTCTTTCTCGTTGCCC No data
Right 1158622155 18:59042261-59042283 GCATGCCCACACACACAGCGAGG No data
1158622150_1158622155 8 Left 1158622150 18:59042230-59042252 CCTCTCTTGATGAACTTGCAGGC No data
Right 1158622155 18:59042261-59042283 GCATGCCCACACACACAGCGAGG No data
1158622148_1158622155 9 Left 1158622148 18:59042229-59042251 CCCTCTCTTGATGAACTTGCAGG No data
Right 1158622155 18:59042261-59042283 GCATGCCCACACACACAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158622155 Original CRISPR GCATGCCCACACACACAGCG AGG Intergenic
No off target data available for this crispr