ID: 1158624154

View in Genome Browser
Species Human (GRCh38)
Location 18:59057182-59057204
Sequence CTGGCCAGGACTTCCCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158624144_1158624154 -7 Left 1158624144 18:59057166-59057188 CCCAGCCTGCCCCTTTCTGGCCA No data
Right 1158624154 18:59057182-59057204 CTGGCCAGGACTTCCCGGGGAGG No data
1158624141_1158624154 9 Left 1158624141 18:59057150-59057172 CCAGGTAATGCGGTTCCCCAGCC 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1158624154 18:59057182-59057204 CTGGCCAGGACTTCCCGGGGAGG No data
1158624145_1158624154 -8 Left 1158624145 18:59057167-59057189 CCAGCCTGCCCCTTTCTGGCCAG No data
Right 1158624154 18:59057182-59057204 CTGGCCAGGACTTCCCGGGGAGG No data
1158624139_1158624154 19 Left 1158624139 18:59057140-59057162 CCATCAGAAACCAGGTAATGCGG 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1158624154 18:59057182-59057204 CTGGCCAGGACTTCCCGGGGAGG No data
1158624143_1158624154 -6 Left 1158624143 18:59057165-59057187 CCCCAGCCTGCCCCTTTCTGGCC No data
Right 1158624154 18:59057182-59057204 CTGGCCAGGACTTCCCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158624154 Original CRISPR CTGGCCAGGACTTCCCGGGG AGG Intergenic
No off target data available for this crispr