ID: 1158624471

View in Genome Browser
Species Human (GRCh38)
Location 18:59059298-59059320
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158624471_1158624474 9 Left 1158624471 18:59059298-59059320 CCAACTTTGGCTGAGGTGGGGCC No data
Right 1158624474 18:59059330-59059352 CTGTTTGCGCACCATGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158624471 Original CRISPR GGCCCCACCTCAGCCAAAGT TGG (reversed) Intergenic
No off target data available for this crispr