ID: 1158624879

View in Genome Browser
Species Human (GRCh38)
Location 18:59062492-59062514
Sequence GGTTGCACAAATTTGCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158624879_1158624887 27 Left 1158624879 18:59062492-59062514 CCCATGTGCAAATTTGTGCAACC No data
Right 1158624887 18:59062542-59062564 CTGTCACCACAAAGATCTCCTGG No data
1158624879_1158624881 -7 Left 1158624879 18:59062492-59062514 CCCATGTGCAAATTTGTGCAACC No data
Right 1158624881 18:59062508-59062530 TGCAACCACCCCCACAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158624879 Original CRISPR GGTTGCACAAATTTGCACAT GGG (reversed) Intergenic
No off target data available for this crispr