ID: 1158627052

View in Genome Browser
Species Human (GRCh38)
Location 18:59080554-59080576
Sequence ATACTTGGAGTACTATTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158627048_1158627052 26 Left 1158627048 18:59080505-59080527 CCTTTAAGGGTTTGTCATAGATT No data
Right 1158627052 18:59080554-59080576 ATACTTGGAGTACTATTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158627052 Original CRISPR ATACTTGGAGTACTATTTAT AGG Intergenic
No off target data available for this crispr