ID: 1158629115

View in Genome Browser
Species Human (GRCh38)
Location 18:59096627-59096649
Sequence GTGTCCAAATGGAAGCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158629115_1158629120 25 Left 1158629115 18:59096627-59096649 CCTGCATGCTTCCATTTGGACAC No data
Right 1158629120 18:59096675-59096697 CAGGCTTCCTGGAGACAAACAGG No data
1158629115_1158629119 14 Left 1158629115 18:59096627-59096649 CCTGCATGCTTCCATTTGGACAC No data
Right 1158629119 18:59096664-59096686 TAGCACTTCAGCAGGCTTCCTGG No data
1158629115_1158629118 6 Left 1158629115 18:59096627-59096649 CCTGCATGCTTCCATTTGGACAC No data
Right 1158629118 18:59096656-59096678 CTGGCTAATAGCACTTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158629115 Original CRISPR GTGTCCAAATGGAAGCATGC AGG (reversed) Intergenic
No off target data available for this crispr