ID: 1158632633

View in Genome Browser
Species Human (GRCh38)
Location 18:59129411-59129433
Sequence CCTATTGTAAACCAGGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158632628_1158632633 11 Left 1158632628 18:59129377-59129399 CCACTTTCAGGTGGTACCAGCAT No data
Right 1158632633 18:59129411-59129433 CCTATTGTAAACCAGGCTTGAGG No data
1158632629_1158632633 -5 Left 1158632629 18:59129393-59129415 CCAGCATATCATGCAGACCCTAT No data
Right 1158632633 18:59129411-59129433 CCTATTGTAAACCAGGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158632633 Original CRISPR CCTATTGTAAACCAGGCTTG AGG Intergenic
No off target data available for this crispr