ID: 1158632879

View in Genome Browser
Species Human (GRCh38)
Location 18:59131773-59131795
Sequence GGCTGCACACCCCATGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158632872_1158632879 12 Left 1158632872 18:59131738-59131760 CCATCACACTAGCTGTAGCAGAG No data
Right 1158632879 18:59131773-59131795 GGCTGCACACCCCATGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158632879 Original CRISPR GGCTGCACACCCCATGGAGC TGG Intergenic
No off target data available for this crispr