ID: 1158635399

View in Genome Browser
Species Human (GRCh38)
Location 18:59151767-59151789
Sequence CTAGAAATACAGCTTGACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158635399 Original CRISPR CTAGAAATACAGCTTGACGG GGG (reversed) Intronic
903576367 1:24342034-24342056 CTAGAAATACAGGATCACTGTGG + Intronic
905688691 1:39927149-39927171 CTGGAACTACAGCTTGAGGCAGG - Intergenic
909141402 1:71870550-71870572 CTACAATTACAGCTTGCAGGTGG + Intronic
911322659 1:96433966-96433988 CTAGAAATACCACTTGACCCGGG - Intergenic
912764603 1:112396763-112396785 CTAGACAGCCAGCTTTACGGAGG + Intronic
914985573 1:152454288-152454310 CTACAAATACAGCTAAACAGAGG - Intergenic
922383349 1:225056063-225056085 CTAGAAATACCGTTTGACCCAGG - Intronic
1062961859 10:1578425-1578447 CTAGAAATAAAGCCTCACGCAGG - Intronic
1063255046 10:4318312-4318334 CAAGAATTAGAGCTTGATGGAGG - Intergenic
1063433713 10:6013667-6013689 GTGGAAATACCGTTTGACGGTGG - Intronic
1069164604 10:65137286-65137308 CTAGAAAGAAAGCTTGACAAAGG + Intergenic
1082036368 11:47648425-47648447 CTAGAAAAACAGGTTGTAGGAGG - Intergenic
1082958890 11:58900578-58900600 CTAAAAACCCAGCGTGACGGGGG + Intronic
1086409643 11:86531462-86531484 CTAGAAATACCACTTGACCCAGG + Intronic
1091033029 11:132208420-132208442 CTAAGAATACAGTTTGAAGGAGG - Intronic
1101522163 12:105494072-105494094 CTCAAAATAAAGTTTGACGGTGG - Intergenic
1103702460 12:122855076-122855098 CTTGAAGTACAGCATGTCGGAGG - Exonic
1104542613 12:129681356-129681378 CTACACATGGAGCTTGACGGAGG + Intronic
1111555634 13:89877623-89877645 CTACAAATGCAGCTTTAGGGAGG - Intergenic
1115718422 14:36131751-36131773 CTAGAAATACAGCTTGAAACAGG - Intergenic
1120194315 14:81465934-81465956 CTAGAAAAACAGCTTCAAGGAGG - Intergenic
1121649270 14:95545162-95545184 CTAGAAACATATCTTTACGGTGG + Intergenic
1127507112 15:59608141-59608163 GTGGAAATACAGCTTGTTGGTGG - Intronic
1140237505 16:73172426-73172448 CTATAAATACAGCTCGGCTGGGG - Intergenic
1143004011 17:3815213-3815235 TTAGAAAGACAACTTGAGGGTGG - Intronic
1148394339 17:47296107-47296129 CTAGAAGTACAGCTTGGATGAGG - Intronic
1148844443 17:50520978-50521000 CTAAAAATACAGCTTCCCTGTGG - Intronic
1158041843 18:53103900-53103922 CTAGAAACACAGCTGGACTAGGG + Intronic
1158635399 18:59151767-59151789 CTAGAAATACAGCTTGACGGGGG - Intronic
1165181666 19:33976904-33976926 CTAGAAACACAGCCTGGAGGAGG + Intergenic
933278613 2:80308018-80308040 CCAGAAGTATAGCTTGACGGAGG + Intronic
935185906 2:100732621-100732643 CTAGAAAGACGGCATGACTGAGG - Intergenic
939755780 2:146108165-146108187 CTAGATTTACAACTTGATGGGGG - Intergenic
941077799 2:161025878-161025900 CTAGGAATACAGCTTAACCAGGG + Intergenic
943850261 2:192711522-192711544 CTAGATAAACAGGTTGAGGGTGG + Intergenic
945818832 2:214638147-214638169 CTAGAAATTCAACTTGATGAGGG + Intergenic
946051930 2:216870145-216870167 CTAGAAAGAGATCTTGAGGGAGG - Intergenic
946884432 2:224209017-224209039 CAAGGAATACAGAGTGACGGTGG - Intergenic
947221650 2:227799069-227799091 CTTGAAATCCAGGTTGAGGGAGG - Intergenic
947501950 2:230677323-230677345 CTTGAAATCCAGCTTGTGGGTGG + Intergenic
1171287084 20:23949252-23949274 CTAGAAATACAGCTTACCAGAGG - Intergenic
1173307880 20:41867944-41867966 CTAGAAATACAGCTAACCAGAGG + Intergenic
1174910671 20:54604241-54604263 CTAAAAATACAGTTTGAGGCCGG - Intronic
1177410662 21:20726430-20726452 ATAGAAATACATCTTCAGGGAGG + Intergenic
1179935136 21:44599275-44599297 CTAGAAATTCAGTTACACGGTGG - Intronic
1182059491 22:27386833-27386855 CAAGAAATACAGTTTGAGGAGGG + Intergenic
951077751 3:18417122-18417144 TCAGAAATACAGCTTGGGGGTGG + Intronic
951153818 3:19324612-19324634 CTAGGAATACAGCTTGCTAGGGG + Intronic
954785302 3:53088217-53088239 CGGGAAATACAGCTTAAGGGGGG + Intronic
959881663 3:111450479-111450501 CTAGAAATTCAGCTTGATTTTGG - Intronic
963636571 3:147804910-147804932 CAAGAAATACAGCTTATTGGAGG - Intergenic
965295232 3:166936959-166936981 CTAGGAATACAGCTTAACAAGGG - Intergenic
965510062 3:169558363-169558385 CTAGAAAAACAGCAGGATGGAGG - Intronic
972306467 4:37835058-37835080 TCAGAAATGCAGCTTGACGTGGG - Intronic
972594069 4:40514817-40514839 ATAGAAATAAACCTTGACGCTGG + Intronic
974355127 4:60802650-60802672 TTAGAAAGACAGGTTGAGGGAGG - Intergenic
975936329 4:79585580-79585602 CTAGAAATAGATCCTGACGTGGG + Intergenic
977967276 4:103167951-103167973 CTAGGACTACAGCTTGAGGAGGG - Intronic
983387584 4:167084919-167084941 CTGGAAATTCAGTTTGACAGTGG + Intronic
986239291 5:5943058-5943080 ATAAAAATAGAGCTTTACGGAGG - Intergenic
991588563 5:68224916-68224938 CTATAAAGACAGCTTGATGGAGG - Intronic
994760249 5:103842933-103842955 ATAGAAATAGAGCTTCACAGGGG + Intergenic
995402311 5:111757215-111757237 CTAGAAAGACAGATTGGGGGGGG + Intronic
1001753943 5:174151937-174151959 CCAGAAATACAACTTGGCGAGGG - Intronic
1004864152 6:19837340-19837362 CTATAAATACAGCTGCGCGGCGG + Intergenic
1005645625 6:27835136-27835158 CTTGAAAAACAGTTTGAGGGAGG - Intergenic
1009730237 6:67592957-67592979 CTAGAATTAGAGCTTGAAGAAGG + Intergenic
1009921919 6:70072760-70072782 AAAGAAACACATCTTGACGGGGG - Intronic
1014567098 6:122962771-122962793 CTAGGAATACAGCTAGCCAGGGG + Intergenic
1016497352 6:144679099-144679121 CTATAAATACATCTTGAATGAGG - Intronic
1017135665 6:151145454-151145476 CTAGAAAGAAATGTTGACGGTGG - Intergenic
1021529159 7:21623428-21623450 CTAGAAATACCGTTTGACCCAGG + Intronic
1021681647 7:23138821-23138843 TTAGAAATACATCTTCATGGTGG - Intronic
1022935225 7:35168583-35168605 CTTGAAATATAGCTTGAAGTTGG - Intergenic
1029105752 7:98174345-98174367 GTAGAAATACAACTTCACTGTGG - Intronic
1029831178 7:103261359-103261381 CTTGAAATATAGCTTGAAGTTGG - Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1042599579 8:70485263-70485285 CTAGAAATACATCTAGAAAGGGG + Intergenic
1045152293 8:99422362-99422384 CTGGAAATATTGCTTGACGGTGG + Intronic
1053861158 9:42387451-42387473 ATAGAAATACAGCTTCACAGAGG - Intergenic
1057801577 9:98194368-98194390 CTTGAATTACAGCTGGACGGTGG + Intergenic
1061475481 9:130862996-130863018 GAAGAAATACAGCCTGACGGTGG + Exonic
1187308001 X:18114675-18114697 CTGGAACTACAGCTTGAAGGAGG - Intergenic
1191893894 X:65972898-65972920 CAAGAAAGACATCTTGAAGGAGG + Intergenic
1198987925 X:142477830-142477852 TTAGAAATACAGCATGTCGGAGG + Intergenic