ID: 1158641762

View in Genome Browser
Species Human (GRCh38)
Location 18:59209563-59209585
Sequence GACCTTCCAAGGTGTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158641762_1158641766 10 Left 1158641762 18:59209563-59209585 CCTCCCACACACCTTGGAAGGTC No data
Right 1158641766 18:59209596-59209618 TTTAGCAGATTGTGTCTTTAAGG No data
1158641762_1158641767 25 Left 1158641762 18:59209563-59209585 CCTCCCACACACCTTGGAAGGTC No data
Right 1158641767 18:59209611-59209633 CTTTAAGGAGATTTTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158641762 Original CRISPR GACCTTCCAAGGTGTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr