ID: 1158641765

View in Genome Browser
Species Human (GRCh38)
Location 18:59209574-59209596
Sequence ATTCTTAAGTCGACCTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158641765_1158641766 -1 Left 1158641765 18:59209574-59209596 CCTTGGAAGGTCGACTTAAGAAT No data
Right 1158641766 18:59209596-59209618 TTTAGCAGATTGTGTCTTTAAGG No data
1158641765_1158641767 14 Left 1158641765 18:59209574-59209596 CCTTGGAAGGTCGACTTAAGAAT No data
Right 1158641767 18:59209611-59209633 CTTTAAGGAGATTTTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158641765 Original CRISPR ATTCTTAAGTCGACCTTCCA AGG (reversed) Intergenic
No off target data available for this crispr