ID: 1158641767

View in Genome Browser
Species Human (GRCh38)
Location 18:59209611-59209633
Sequence CTTTAAGGAGATTTTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158641762_1158641767 25 Left 1158641762 18:59209563-59209585 CCTCCCACACACCTTGGAAGGTC No data
Right 1158641767 18:59209611-59209633 CTTTAAGGAGATTTTGCAGCTGG No data
1158641764_1158641767 21 Left 1158641764 18:59209567-59209589 CCACACACCTTGGAAGGTCGACT No data
Right 1158641767 18:59209611-59209633 CTTTAAGGAGATTTTGCAGCTGG No data
1158641765_1158641767 14 Left 1158641765 18:59209574-59209596 CCTTGGAAGGTCGACTTAAGAAT No data
Right 1158641767 18:59209611-59209633 CTTTAAGGAGATTTTGCAGCTGG No data
1158641763_1158641767 22 Left 1158641763 18:59209566-59209588 CCCACACACCTTGGAAGGTCGAC No data
Right 1158641767 18:59209611-59209633 CTTTAAGGAGATTTTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158641767 Original CRISPR CTTTAAGGAGATTTTGCAGC TGG Intergenic
No off target data available for this crispr