ID: 1158647743

View in Genome Browser
Species Human (GRCh38)
Location 18:59262986-59263008
Sequence GGCCATGCTCCTTGAGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158647738_1158647743 -5 Left 1158647738 18:59262968-59262990 CCTTATTTCCCCTCCTTAGGCCA No data
Right 1158647743 18:59262986-59263008 GGCCATGCTCCTTGAGTGTTAGG No data
1158647734_1158647743 30 Left 1158647734 18:59262933-59262955 CCAGTAGGCATTTGGAAATTTAT No data
Right 1158647743 18:59262986-59263008 GGCCATGCTCCTTGAGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158647743 Original CRISPR GGCCATGCTCCTTGAGTGTT AGG Intergenic
No off target data available for this crispr