ID: 1158648064

View in Genome Browser
Species Human (GRCh38)
Location 18:59264891-59264913
Sequence GGGCGCCTCCGCGGTCCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158648060_1158648064 -7 Left 1158648060 18:59264875-59264897 CCAGGACACCGAGCGAGGGCGCC No data
Right 1158648064 18:59264891-59264913 GGGCGCCTCCGCGGTCCTACGGG No data
1158648050_1158648064 25 Left 1158648050 18:59264843-59264865 CCTGGACCGGTCCAGGGCCGCAG No data
Right 1158648064 18:59264891-59264913 GGGCGCCTCCGCGGTCCTACGGG No data
1158648051_1158648064 19 Left 1158648051 18:59264849-59264871 CCGGTCCAGGGCCGCAGTGCCTA No data
Right 1158648064 18:59264891-59264913 GGGCGCCTCCGCGGTCCTACGGG No data
1158648052_1158648064 14 Left 1158648052 18:59264854-59264876 CCAGGGCCGCAGTGCCTAACCCC No data
Right 1158648064 18:59264891-59264913 GGGCGCCTCCGCGGTCCTACGGG No data
1158648058_1158648064 -5 Left 1158648058 18:59264873-59264895 CCCCAGGACACCGAGCGAGGGCG No data
Right 1158648064 18:59264891-59264913 GGGCGCCTCCGCGGTCCTACGGG No data
1158648059_1158648064 -6 Left 1158648059 18:59264874-59264896 CCCAGGACACCGAGCGAGGGCGC No data
Right 1158648064 18:59264891-59264913 GGGCGCCTCCGCGGTCCTACGGG No data
1158648054_1158648064 8 Left 1158648054 18:59264860-59264882 CCGCAGTGCCTAACCCCAGGACA No data
Right 1158648064 18:59264891-59264913 GGGCGCCTCCGCGGTCCTACGGG No data
1158648055_1158648064 0 Left 1158648055 18:59264868-59264890 CCTAACCCCAGGACACCGAGCGA No data
Right 1158648064 18:59264891-59264913 GGGCGCCTCCGCGGTCCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158648064 Original CRISPR GGGCGCCTCCGCGGTCCTAC GGG Intergenic
No off target data available for this crispr