ID: 1158648808

View in Genome Browser
Species Human (GRCh38)
Location 18:59269114-59269136
Sequence CCCCGAAGCCGGGCCCGCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158648802_1158648808 -2 Left 1158648802 18:59269093-59269115 CCTCGTCCAGCGGGAACTTGTCC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1158648808 18:59269114-59269136 CCCCGAAGCCGGGCCCGCACGGG 0: 1
1: 0
2: 0
3: 13
4: 133
1158648797_1158648808 25 Left 1158648797 18:59269066-59269088 CCGCGATGCTGCTGTTGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1158648808 18:59269114-59269136 CCCCGAAGCCGGGCCCGCACGGG 0: 1
1: 0
2: 0
3: 13
4: 133
1158648803_1158648808 -8 Left 1158648803 18:59269099-59269121 CCAGCGGGAACTTGTCCCCGAAG 0: 1
1: 0
2: 0
3: 7
4: 40
Right 1158648808 18:59269114-59269136 CCCCGAAGCCGGGCCCGCACGGG 0: 1
1: 0
2: 0
3: 13
4: 133
1158648801_1158648808 1 Left 1158648801 18:59269090-59269112 CCGCCTCGTCCAGCGGGAACTTG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1158648808 18:59269114-59269136 CCCCGAAGCCGGGCCCGCACGGG 0: 1
1: 0
2: 0
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158648808 Original CRISPR CCCCGAAGCCGGGCCCGCAC GGG Exonic
900002379 1:21777-21799 CCGCGAAGGCCGGCCTGCACAGG - Intergenic
900022098 1:192301-192323 CCGCGAAGGCCGGCCTGCACAGG - Intergenic
900310954 1:2032870-2032892 CCACGCAGCCAGGCCCGCCCGGG + Intergenic
901641221 1:10694154-10694176 CCCCCAAGCCGGGGCCGCGCCGG - Intronic
902769326 1:18636625-18636647 CCCCGCAGCCGGGCTCTCCCGGG - Intronic
903945580 1:26960269-26960291 CCCCGAAGCTGAGCCCGGACAGG - Intronic
905199523 1:36306687-36306709 CCGCGAAGCCAGCCCCGCGCGGG - Exonic
906214322 1:44030364-44030386 CCCCGCCCCCGGGCCGGCACCGG + Intronic
914908068 1:151763075-151763097 GCCGGAAGCCGCGCCTGCACCGG - Exonic
915485359 1:156216607-156216629 ACCCGGACCCGGGCCGGCACCGG - Intronic
922315183 1:224435071-224435093 CTCCGAAGCCGGGCGTGCATGGG + Intronic
1064194273 10:13232862-13232884 CCCTGAAGCCGGGGCTCCACAGG + Intronic
1065521671 10:26579696-26579718 GCCCCAGGCAGGGCCCGCACAGG + Intergenic
1066439107 10:35421069-35421091 CCCCAAAGCAGAGCCGGCACTGG - Intronic
1077074715 11:695110-695132 GCCCGAAGCGGGGCCCGAAGAGG + Exonic
1077144100 11:1037106-1037128 CCCCCAAGCTGGGTCAGCACTGG - Intergenic
1084510686 11:69601724-69601746 CCCAGAAGCCAGGCCAACACAGG - Intergenic
1085022493 11:73218271-73218293 CCCCGAAGCCGGGCCAGGCAGGG - Intergenic
1091375797 12:23839-23861 CCGCGAAGGCCGGCCTGCACAGG - Intergenic
1096102476 12:48978242-48978264 CCCCGCCTCCGGGCCTGCACTGG - Intergenic
1102515258 12:113441930-113441952 CCCCAGAGCTGGGCCCACACAGG + Intergenic
1104679533 12:130739864-130739886 CCCCGCAGAGGGGCCCCCACGGG + Intergenic
1105472058 13:20703720-20703742 CCCCGAGCCGGGGGCCGCACGGG - Intronic
1105509250 13:21037750-21037772 TCCCGCAGCAGGGCCAGCACTGG + Intronic
1108340675 13:49496052-49496074 CCCGGAGGCCCGGCCCGCGCAGG + Exonic
1110414815 13:75240456-75240478 CCCCGCAGCCGGCTCCGCAGTGG - Intergenic
1113902645 13:113805274-113805296 CCCCGGGGCTGGCCCCGCACAGG + Intronic
1116003368 14:39267316-39267338 CCCCGCAGCCGGCTCCGCAGTGG + Exonic
1117176778 14:53153363-53153385 CCCGGAAGCCCGGGCTGCACCGG + Intergenic
1119706881 14:76788561-76788583 CCCAGACGCCGGGCCTGCCCTGG + Exonic
1122908913 14:104816710-104816732 CCCCAAAGCTGGGCCCGGTCAGG - Intergenic
1131096034 15:89654952-89654974 CGCGGAAGCCGGGACTGCACCGG - Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131635780 15:94231643-94231665 CCCCGAACGCGGCCTCGCACAGG + Intronic
1132451133 15:101969162-101969184 CCGCGAAGGCCGGCCTGCACAGG + Intergenic
1132700573 16:1220448-1220470 CCCTGAGGCCGAGCCCGCTCTGG + Exonic
1133220935 16:4318890-4318912 CCCCAAACCCTGGCCGGCACTGG - Intronic
1133336293 16:5008698-5008720 CCCAGAAGCCTGGCACGCAGTGG - Intronic
1135400829 16:22165373-22165395 CCACCACGCCGGGCCCACACTGG + Intergenic
1138553337 16:57758843-57758865 GCCTGAAGCTGGGCCCTCACTGG - Exonic
1139582691 16:67882741-67882763 CCCCGCAGCTGGGCTAGCACAGG - Exonic
1140469048 16:75204642-75204664 CCCCAAGGCCTGGCCCTCACTGG + Intronic
1141443281 16:84042854-84042876 CCCCGGGGCCGGGCCTGCAGGGG - Intergenic
1141628947 16:85276572-85276594 CCCCGAACCCGGGCCCTTTCTGG - Intergenic
1141882348 16:86868305-86868327 TCCCGAAGCTGGGCCAGCCCTGG - Intergenic
1142860048 17:2755811-2755833 CCCCGAGGCCCGGCCGGCGCGGG + Intergenic
1148725846 17:49789259-49789281 CGCCTAAGCCGCGCCCCCACAGG - Intronic
1151314307 17:73312212-73312234 CCCGGAAGCCGGGCGGGCCCAGG - Intergenic
1151727831 17:75894823-75894845 CCCCGCAGCCTGGCCACCACCGG - Intronic
1152744397 17:82032203-82032225 CCCCGGAGCCCGGCCTGCCCAGG + Intronic
1154502990 18:15005727-15005749 ACCCCAAGCCGGGCCCACCCGGG + Intergenic
1155081799 18:22418010-22418032 CCCCGCAGCCGGCTCCGCAGTGG - Intergenic
1158648808 18:59269114-59269136 CCCCGAAGCCGGGCCCGCACGGG + Exonic
1160562830 18:79770459-79770481 CCCCGGAGCCGGCCCAGCACGGG + Intergenic
1160634131 19:63385-63407 CCGCGAAGGCCGGCCTGCACAGG - Intergenic
1160731642 19:643993-644015 CCTCGAAGCCGGTCCCGTCCCGG + Intergenic
1161061144 19:2215600-2215622 CCCCGGAGGCGGGCTCTCACGGG + Intronic
1161620078 19:5293092-5293114 CCCCGAGGCCCGGGCCGCCCCGG - Intronic
1161800724 19:6415633-6415655 CCCCGTCCCCGGCCCCGCACCGG - Exonic
1163034552 19:14563366-14563388 CCCAGAAGCCTGGGCCACACTGG - Intronic
1163517302 19:17772756-17772778 CCCCGAAGCCCGACCCCCAATGG - Intronic
1163701454 19:18788711-18788733 CCACGAAGCCGGGCTGGCACGGG + Exonic
1165068093 19:33240614-33240636 CACAGAAGCCGGGCACCCACAGG - Intergenic
1165958372 19:39515758-39515780 CAGCGAGGCCGGGCCCGCCCCGG + Exonic
1166529327 19:43533386-43533408 CCCCGACGCCGGACGCGCGCCGG + Exonic
1166986161 19:46661012-46661034 CCCCGCAGCCGGCCCCGCTCAGG + Exonic
1167258271 19:48443584-48443606 CCCCGACGCCGGGCCCGCTGCGG + Exonic
1167268197 19:48493663-48493685 CCCCGAAACCGCGCCCTCTCGGG + Intronic
1167448854 19:49555804-49555826 CCGCGAAGCCGGTACCGCCCTGG + Exonic
1167612807 19:50515387-50515409 CCCCCCAGCCAGGCCCGCTCAGG + Intergenic
1168111160 19:54191926-54191948 TCCCGAAGCCTGGCCATCACTGG - Exonic
1168465098 19:56595387-56595409 CCCCGAGGCCGCGCCCTCCCCGG - Exonic
926121369 2:10242968-10242990 TCCCGGAGCCGGGCCAGCCCTGG - Intergenic
926320772 2:11746938-11746960 CAGCCAAGCCGGGCCCACACCGG - Intronic
927561306 2:24076274-24076296 CCCCGAAGCCGAGCGAGCTCCGG - Exonic
927695798 2:25239036-25239058 CCCCTGAGCCGGGCCCTCTCTGG - Intronic
927937966 2:27086116-27086138 CGCCGCACCCGGGCCCGCAGCGG + Exonic
927997269 2:27494975-27494997 CCGCGTCGCCGGGCCCGCGCCGG - Exonic
936567348 2:113591643-113591665 CCGCGAAGGCCGGCCTGCACAGG + Intergenic
947749858 2:232526371-232526393 CCCAGAAGGCGGCCCCCCACAGG - Intronic
948045508 2:234940646-234940668 CCCCAAAGCTGAGCCCGCAGCGG + Intergenic
948436146 2:237955853-237955875 CCCCGAAGCCGGGTCCTCCCGGG - Intergenic
1169557808 20:6768413-6768435 TCCCGGAGCCGGCCCCGCGCGGG + Exonic
1170578836 20:17682783-17682805 CCCCGAAGCAGCGCCCCCTCGGG + Intergenic
1170890330 20:20369873-20369895 CCCCGAACCCGAGTCCGCGCTGG + Exonic
1171006273 20:21468322-21468344 ACCAAAAGCCAGGCCCGCACTGG + Intergenic
1172272767 20:33663801-33663823 CCGCGAAGCCGGCCCCGCCGAGG + Exonic
1172841087 20:37903162-37903184 CCCCGAAGCCGGGGCTGGGCCGG + Exonic
1173599938 20:44287448-44287470 CCCCAAAGCCCGCCCCGAACAGG + Intergenic
1174573905 20:51523763-51523785 CCTCGAAGCCGGGCACGGGCAGG + Exonic
1175399498 20:58692647-58692669 GCCCGAAGCCGGCCCCGAGCAGG - Exonic
1175917006 20:62430643-62430665 CCCCCCAGCCGGGCCAGCAAGGG - Intergenic
1176074614 20:63242815-63242837 CCCCGATGCCGTCCCCGCACAGG - Intronic
1176546906 21:8206155-8206177 ACCCGGACCCGGGCCGGCACCGG - Intergenic
1176554811 21:8250364-8250386 ACCCGGACCCGGGCCGGCACCGG - Intergenic
1176565857 21:8389202-8389224 ACCCGGACCCGGGCCGGCACCGG - Intergenic
1176573732 21:8433389-8433411 ACCCGGACCCGGGCCGGCACCGG - Intergenic
1176952501 21:15064436-15064458 CCCCGAGTCCGGCCCCGCTCAGG + Intronic
1178914445 21:36698917-36698939 CCCCGAACCCGGGAGCGCGCGGG + Intergenic
1179582205 21:42351131-42351153 CCCGGAAGCCTCGCCTGCACAGG - Intergenic
1179643363 21:42761142-42761164 GCCTGAAGCCAGGCCCGCACAGG - Intronic
1179780356 21:43696231-43696253 CCCCGGAGCAGCGCCCCCACCGG - Intergenic
1181688065 22:24542942-24542964 CACCCCAGCCGGGCCCGCTCAGG - Exonic
1182429007 22:30289365-30289387 TCCCGAACCCGGGCGCGCACCGG + Exonic
1183195715 22:36352139-36352161 CTCGGAAGCCAGGCCGGCACTGG + Intronic
1185187760 22:49413148-49413170 CCCCCATGCCTGGCCAGCACTGG - Intergenic
1185278732 22:49960980-49961002 CCACGCCGCCGGGCCCGCAGAGG - Exonic
1185370156 22:50457153-50457175 CCCCCAAGCTGGGCACGCCCAGG - Intronic
1185389086 22:50549181-50549203 CCCCGAAGCGGGGCCTCCTCGGG - Exonic
1203251781 22_KI270733v1_random:122440-122462 ACCCGGACCCGGGCCGGCACCGG - Intergenic
1203259831 22_KI270733v1_random:167522-167544 ACCCGGACCCGGGCCGGCACCGG - Intergenic
951259825 3:20494924-20494946 ACCTGAAGCCGGGACAGCACTGG + Intergenic
954632765 3:52056223-52056245 CCCCGTCGCCGCGCCCGCCCCGG + Exonic
955239039 3:57164224-57164246 CCCTGACGCCGGGCCCACCCGGG + Intronic
956797818 3:72732202-72732224 CCTCCAAGCCAGGCCTGCACGGG - Intergenic
958432856 3:94062755-94062777 CGCAGAAGCAGGGGCCGCACAGG + Intronic
961873325 3:130003267-130003289 GCCCGTAGCCAGGCCCGCTCCGG + Intergenic
968230797 3:197003477-197003499 CCCCGAAGCCCGGGCCGCGGTGG + Intronic
968809505 4:2793491-2793513 CCCCGAAGCCGCGCTCCCTCGGG - Intronic
968897412 4:3412882-3412904 CCCTGAAGCTGGGCTCACACTGG + Intronic
969296128 4:6271398-6271420 CCCAGAAGCCTGTCCAGCACTGG - Intronic
973931073 4:55793696-55793718 CCCTGAGGCCGCGCCCGCCCGGG - Intergenic
985588935 5:754953-754975 CCCCCAAGCCTGGCCCGTGCCGG + Intronic
985603615 5:847469-847491 CCCCCAAGCCTGGCCCGTGCCGG + Intronic
985876083 5:2596972-2596994 CCCAGAAGCCGGGGGCGCAACGG + Intergenic
986094253 5:4539781-4539803 CCCAGCAGCCGGGACCCCACTGG + Intergenic
991351115 5:65721855-65721877 CTCCGGACCGGGGCCCGCACCGG - Intronic
1002541191 5:179907601-179907623 CGCCGAGGCCGGGCCGGAACCGG + Intronic
1019419692 7:945327-945349 CCCAGCAGCAGGGCCCCCACAGG + Intronic
1034430926 7:151040831-151040853 CCTCGAAGCCGGGGCGGCAGGGG - Exonic
1034983831 7:155495634-155495656 CCCCAGAGCAAGGCCCGCACAGG + Intronic
1037620060 8:20555790-20555812 CCTGGAAGCTGGGCCTGCACAGG + Intergenic
1048258662 8:132926058-132926080 CCACTAAGCTGGGCCCTCACTGG + Intronic
1049212256 8:141392172-141392194 CCCCGAAGCCGTGCCCGGAGCGG - Intronic
1049554696 8:143276006-143276028 GCCCGAAGCCGGCGCTGCACCGG - Exonic
1049885185 9:21890-21912 CCGCGAAGGCCGGCCTGCACAGG - Intergenic
1050356967 9:4792837-4792859 GCCCGAAGCGGGGGCCGCCCCGG + Intronic
1051285569 9:15492607-15492629 CCCCGACACCGAGTCCGCACTGG - Intronic
1059375238 9:113876179-113876201 CCCCCACCCCCGGCCCGCACCGG - Intergenic
1060200929 9:121651539-121651561 CCCGGAGGCCGGGCTGGCACCGG - Intronic
1060406119 9:123373885-123373907 CCCCGAAGCCAGGCGGGCAGCGG - Exonic
1060555407 9:124505065-124505087 CCCCCAAGCCCGGCCCGCGCCGG + Intronic
1060947885 9:127580920-127580942 CCCCCAAGCCCAGCCTGCACTGG + Intergenic
1061248383 9:129413286-129413308 CCCCGCCGCGGGGCCCGGACGGG + Intergenic
1061257405 9:129460640-129460662 CCCCGGAGCCGGGCCCGCGGCGG - Intergenic
1203468183 Un_GL000220v1:105591-105613 ACCCGGACCCGGGCCGGCACCGG - Intergenic
1203476004 Un_GL000220v1:149563-149585 ACCCGGACCCGGGCCGGCACCGG - Intergenic