ID: 1158649038

View in Genome Browser
Species Human (GRCh38)
Location 18:59270590-59270612
Sequence CTATATTTATGAAGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158649031_1158649038 28 Left 1158649031 18:59270539-59270561 CCGTTTAGTAGAGAACACAAAAG 0: 1
1: 0
2: 1
3: 25
4: 242
Right 1158649038 18:59270590-59270612 CTATATTTATGAAGGGAAATGGG 0: 1
1: 0
2: 0
3: 22
4: 300
1158649034_1158649038 -3 Left 1158649034 18:59270570-59270592 CCAAACTGGTGGCTTTAGTGCTA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1158649038 18:59270590-59270612 CTATATTTATGAAGGGAAATGGG 0: 1
1: 0
2: 0
3: 22
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158649038 Original CRISPR CTATATTTATGAAGGGAAAT GGG Intronic
900006309 1:55823-55845 CTATATTTATGATGTGATAGAGG - Intergenic
902453545 1:16514863-16514885 CCATATTTATGAAAGTAAAGAGG + Intergenic
902473600 1:16667525-16667547 CCATATTTATGAAAGTAAAGAGG + Intergenic
902485203 1:16739917-16739939 CCATATTTATGAAAGTAAAGAGG - Intergenic
903303876 1:22398874-22398896 ATATATTTATAAAGAGAGATGGG - Intergenic
905032731 1:34898665-34898687 CTATTTTTAAAAAGGGAAAGTGG + Intronic
905058470 1:35119441-35119463 CTGTTTTTATGAAGGGATTTGGG - Intergenic
905310642 1:37046695-37046717 CCATATTTATGGATCGAAATTGG + Intergenic
906158991 1:43633535-43633557 CAATATTGATGCAGGGAATTAGG + Intergenic
906630211 1:47361003-47361025 ACATATTTATGAGGGGAATTGGG + Intronic
906927527 1:50134933-50134955 ATTTATTTAGGAGGGGAAATGGG + Intronic
908154546 1:61339153-61339175 CTATGTTTATAAATGGAACTCGG + Intronic
908207666 1:61868013-61868035 CTATATTTGTGGAGGGCAAATGG + Intronic
909148232 1:71965570-71965592 CTTTATTTATTCATGGAAATGGG + Intronic
909205138 1:72746420-72746442 CCATATTTATGCAATGAAATGGG + Intergenic
909427922 1:75549165-75549187 CTGTATTCAAGAAGGGAATTTGG - Intronic
910174328 1:84412895-84412917 TTCTATTTATGAAGGAAAAAAGG - Intronic
911699065 1:100929136-100929158 CTATATATATGAATGCTAATTGG - Intronic
912999985 1:114570743-114570765 CTAGATTTCTGAAGGAAAAGAGG + Exonic
913577002 1:120185576-120185598 CTATATTTATAAAGGTATACTGG - Intergenic
914005664 1:143730168-143730190 CCATATTTATGAAATGAAAGAGG + Intergenic
914098130 1:144561414-144561436 CCATATTTATGAAATGAAAGAGG + Intergenic
914300851 1:146376202-146376224 CCATATTTATGAAATGAAAGAGG - Intergenic
914517853 1:148389216-148389238 CCATATTTATGAAAGTAAAGAGG + Intergenic
914558911 1:148797011-148797033 CTATATTTATAAAGGTATACTGG - Intergenic
914613922 1:149333219-149333241 CTATATTTATAAAGGTATACTGG + Intergenic
914904713 1:151734461-151734483 ACATATTTAGGAAGGGGAATTGG + Intergenic
915350121 1:155219083-155219105 CCATATTTCTAAAGGGCAATTGG + Intergenic
915353523 1:155241321-155241343 CCATATTTCTAAAGGGCAATTGG + Intronic
915781336 1:158554182-158554204 TTATTTTTATGAAGGAAAGTAGG - Intergenic
916278860 1:163025973-163025995 ATAGATTTATTAAAGGAAATAGG - Intergenic
917681252 1:177370260-177370282 CTTTATTTATAAAGAGAAAAAGG + Intergenic
918779659 1:188682682-188682704 ATATATTTAATAAGGAAAATAGG + Intergenic
919657364 1:200210646-200210668 CTGTTTATATGAATGGAAATTGG + Intergenic
921334262 1:214070647-214070669 GAATATTTATGAAATGAAATAGG + Intergenic
921407400 1:214796064-214796086 CTTTTATTATGAAGGGATATTGG + Intergenic
922046746 1:221952434-221952456 CTATTCATATGATGGGAAATGGG + Intergenic
924551318 1:245080644-245080666 AAATATTTAAGAAGTGAAATTGG - Intronic
1062952928 10:1518357-1518379 GTACAGTTGTGAAGGGAAATTGG - Intronic
1063332028 10:5169287-5169309 CTATAGTTATGAAAGGACAAAGG + Intergenic
1064154202 10:12890110-12890132 GTATTTTTATGAGGGGCAATTGG - Intergenic
1065265903 10:23975196-23975218 CTATTTTTATCAAGAGAAGTTGG + Intronic
1065756304 10:28934403-28934425 CTAAATTTATGATGGAAAGTTGG - Intergenic
1068278335 10:54832991-54833013 CTATATTTATGCAAGAAAAAGGG + Intronic
1068371197 10:56118125-56118147 TTATATTTACTAAGAGAAATAGG - Intergenic
1068980560 10:63058269-63058291 CTGTATTTATTCAGGGAAATGGG + Intergenic
1071222902 10:83490732-83490754 CTAGATATATAAAGGGAATTTGG + Intergenic
1071236868 10:83658932-83658954 CTACCTTTAAGAAGGGAACTTGG + Intergenic
1073861069 10:107741288-107741310 CTATATTTATAGAGGGAAAGAGG + Intergenic
1074435865 10:113433680-113433702 ATATATTTATGAGGGTAGATTGG + Intergenic
1074530341 10:114293005-114293027 CAATATTTATAAAGAAAAATGGG - Intergenic
1074731865 10:116387025-116387047 TTATGTTGATGAAGGGAAATTGG + Intergenic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1075238488 10:120754745-120754767 CTATATTAATCAAGGAAAAAGGG - Intergenic
1076328633 10:129647959-129647981 CTATATTTATGGAATGAAAAGGG - Intronic
1077868125 11:6239822-6239844 CTATCTTTAGGAAGGGAATGTGG - Intronic
1077936401 11:6792101-6792123 GTTTTTTAATGAAGGGAAATAGG + Intergenic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1078880539 11:15444627-15444649 TTATAGTTATGAAGTCAAATAGG + Intergenic
1078920854 11:15828983-15829005 CTACATTTATGAACAGAAAACGG - Intergenic
1079015551 11:16865766-16865788 CCAGATTTATCAAGGGAAGTGGG - Intronic
1079450105 11:20593461-20593483 ATATATTTATTATGGGAAATAGG - Intergenic
1079484968 11:20926257-20926279 CCATATTTTTGAAGGTAAACTGG + Intronic
1079921636 11:26440719-26440741 GTAAAATTATGGAGGGAAATGGG + Intronic
1085779008 11:79391769-79391791 TTAGATTTTTGAAAGGAAATAGG - Intronic
1087951526 11:104226589-104226611 CTCAATATTTGAAGGGAAATTGG + Intergenic
1088608244 11:111551911-111551933 CCATATTTACAAAGGGAAAGGGG - Intronic
1088998551 11:115028160-115028182 CTATATTAATAGAGGCAAATAGG + Intergenic
1092680335 12:10972702-10972724 CTACATTTTTGAAGGGAGTTTGG + Intronic
1092855146 12:12666148-12666170 CTATGTTTCTGAGGGGAAAAGGG - Intronic
1093123595 12:15301796-15301818 CAATATTTTTTAAGGAAAATAGG - Intronic
1093518356 12:20018000-20018022 CTATATTTATGGAGAGCAAAAGG - Intergenic
1093791534 12:23255956-23255978 TTATATTTATAAAGGGGAAGAGG + Intergenic
1095516711 12:43014431-43014453 CTATATATATGCATAGAAATTGG - Intergenic
1095692144 12:45101913-45101935 CTGTATTTAATAAGGCAAATGGG + Intergenic
1095897353 12:47293210-47293232 TTATATTTATTATGAGAAATTGG - Intergenic
1097033585 12:56106919-56106941 CTACATTTCTGAAGGGCACTAGG + Intronic
1098162685 12:67661032-67661054 CTTTATTTATAAATGGAAACCGG + Exonic
1098168417 12:67720621-67720643 ATATCTTTAGGAAGGGAAAAGGG + Intergenic
1098239507 12:68452456-68452478 CTATATTTTTCAAGGGAAAAAGG - Intergenic
1098615018 12:72511565-72511587 TTTTCTTTATGAAGGCAAATAGG - Intronic
1098666914 12:73175869-73175891 CTGTATTTATAACTGGAAATAGG - Intergenic
1099270806 12:80507763-80507785 ATCTATTTATGAAGAAAAATTGG - Intronic
1099700857 12:86079603-86079625 CTATATTCAGCAAGGAAAATAGG + Intronic
1102834389 12:116040972-116040994 CTATAGTTTTTAGGGGAAATGGG - Intronic
1106905445 13:34404115-34404137 CTAAATATATGAAGTAAAATAGG + Intergenic
1108284245 13:48890406-48890428 CTATATTACTGTAGGGAATTTGG - Intergenic
1108866334 13:54927493-54927515 GTATATTTATGAAAAGAAGTGGG - Intergenic
1109467554 13:62756734-62756756 CAACATTAAAGAAGGGAAATGGG - Intergenic
1110195423 13:72782510-72782532 CCTTCTTTTTGAAGGGAAATAGG - Intronic
1110953544 13:81523792-81523814 CTGTATTTATTAAGGGTTATGGG + Intergenic
1111140414 13:84111182-84111204 CTATATGTATGGAGTGAAATTGG + Intergenic
1111688997 13:91537733-91537755 CTATATTTACTAAGAGATATCGG - Intronic
1112265093 13:97916314-97916336 TTATGTGTATGGAGGGAAATGGG + Intergenic
1115036363 14:28861533-28861555 CTATATTTATTGAGAGAAAAGGG - Intergenic
1115042190 14:28944573-28944595 CTATATTTTGAAAGGGAACTTGG - Intergenic
1115654409 14:35429690-35429712 CTATATTTAAGAGTGTAAATTGG - Intergenic
1115848447 14:37565490-37565512 CTATGTTTAAGAAGGCCAATGGG - Intergenic
1116322436 14:43486964-43486986 GTATTTTTATGAAAGGAAATAGG + Intergenic
1116880518 14:50163206-50163228 ATATATTTATGCAAGGATATGGG + Intronic
1117891762 14:60429681-60429703 ATATATTCATGAAGGCATATTGG + Intronic
1119377765 14:74208473-74208495 CTATTTCTATCAAGGAAAATGGG - Intergenic
1120622837 14:86786920-86786942 ATATATGTATAAAAGGAAATAGG + Intergenic
1120701152 14:87700300-87700322 ATATATGTATGAACAGAAATGGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1125133157 15:36308391-36308413 TTATATTTATTATGAGAAATTGG - Intergenic
1125256086 15:37764804-37764826 CTAGATTTAAGTGGGGAAATGGG - Intergenic
1127495604 15:59509119-59509141 CAATAATTATGAAGGAAAAGTGG - Intronic
1128360207 15:66956548-66956570 CTTTAGTTCTGAAGGGAGATGGG + Intergenic
1128948030 15:71843858-71843880 TTATATTTATGATAGGGAATGGG - Intronic
1129373015 15:75109742-75109764 ATGTATTTGGGAAGGGAAATTGG - Intronic
1131709825 15:95040973-95040995 CTAAATTTATCAAGAAAAATTGG + Intergenic
1132447213 15:101935135-101935157 CTATATTTATGATGTGATAGAGG + Intergenic
1137906591 16:52328950-52328972 CTATATTTATAAATGAAATTAGG + Intergenic
1138488773 16:57363940-57363962 CAACATTCATGAAGGGAAGTGGG - Exonic
1138703468 16:58889824-58889846 CGATATTTATGAAAAGCAATGGG + Intergenic
1138931585 16:61664778-61664800 CTATTTTACTGAAGTGAAATTGG + Intronic
1140642670 16:76994622-76994644 ATATCATCATGAAGGGAAATAGG + Intergenic
1140775578 16:78246313-78246335 GTATATGTATGAAGGGAGTTAGG - Intronic
1143073639 17:4320187-4320209 CTATATTTATGATTAGAAAATGG + Intronic
1143074036 17:4324586-4324608 CTTTATTTATAAAGTGAGATAGG + Intronic
1145073084 17:19828064-19828086 CAAGATTTTTGATGGGAAATTGG - Intronic
1148518720 17:48248072-48248094 CTATTTCTATTAAGGCAAATAGG + Intronic
1153136311 18:1921302-1921324 CTATACCTATGGAGAGAAATTGG - Intergenic
1153380850 18:4437815-4437837 TTATATTAAGGTAGGGAAATAGG + Intronic
1156135254 18:34029890-34029912 CTATATTTATTATTGAAAATTGG - Intronic
1156248088 18:35322600-35322622 CTATATTAATGAAGGCAAACAGG - Intergenic
1156598610 18:38577148-38577170 CTATATCTGTGAAGTGAATTGGG - Intergenic
1156864621 18:41874949-41874971 CTATATTTATCATGGAAAAAGGG - Intergenic
1157174466 18:45438740-45438762 CTATATCTATGATAGGAAAATGG + Intronic
1157642995 18:49236617-49236639 CAAGATTCAGGAAGGGAAATAGG + Intronic
1158649038 18:59270590-59270612 CTATATTTATGAAGGGAAATGGG + Intronic
1160638063 19:97398-97420 CTATATTTATGATGTGATAGAGG - Intergenic
1162649471 19:12075913-12075935 CTATGTTCATAAAGGGAATTGGG - Exonic
1164616701 19:29671274-29671296 CTATATCTATGAATAAAAATAGG - Intronic
1168127747 19:54295703-54295725 ATATATTTATCAAGTGAACTTGG + Intergenic
1202705791 1_KI270713v1_random:22601-22623 CCATATTTATGAAAGTAAAGAGG + Intergenic
925298497 2:2793592-2793614 CCGTATTTATGAAAGAAAATGGG - Intergenic
926512023 2:13793061-13793083 CTATATTAGTGAAGGGACATAGG + Intergenic
927223600 2:20738718-20738740 GTATATTAAAGAATGGAAATTGG + Intronic
928301412 2:30128727-30128749 CAATATTTGTGGAGGGCAATGGG - Intergenic
928992799 2:37252853-37252875 ATATATATATAAAGAGAAATGGG + Exonic
929176134 2:38978347-38978369 CTATATATCTGAAGGGAATGAGG - Intergenic
929355019 2:41012882-41012904 CAATATATATGAGGGAAAATCGG + Intergenic
930794018 2:55368623-55368645 CTATATTCATGAAAAGAAATAGG - Intronic
931123805 2:59251452-59251474 CTATATTTATGAACTAAATTGGG - Intergenic
931351395 2:61491959-61491981 CTGTATGTATCAATGGAAATAGG - Intronic
931552064 2:63457518-63457540 CTATTTTTATTTAGGGATATTGG - Intronic
934163476 2:89273648-89273670 CTGTATGTATGAAGTGCAATAGG + Intergenic
934203798 2:89908876-89908898 CTGTATGTATGAAGTGCAATAGG - Intergenic
936495304 2:113015346-113015368 CTATTTTGTGGAAGGGAAATTGG + Intergenic
937020376 2:118645271-118645293 CTATTTTCATGAAGAGAACTTGG + Intergenic
939281571 2:140072305-140072327 TTGTATTTAAGAAGGGAAACGGG - Intergenic
939672455 2:145029900-145029922 TTATAGTTATGAAAGTAAATTGG + Intergenic
940167350 2:150789205-150789227 ATATATTTATGAAGTACAATAGG - Intergenic
940472850 2:154120759-154120781 CCATATTTTTGAAGGCAACTAGG + Intronic
941731123 2:168919458-168919480 CTAGATTGAGGCAGGGAAATGGG - Intergenic
942002965 2:171668517-171668539 CTATATTAATGATGGGAGGTGGG - Intergenic
942915538 2:181301463-181301485 CTATAATGATCCAGGGAAATTGG - Intergenic
944367217 2:198935919-198935941 CTATATATATGTATGGCAATAGG + Intergenic
944982609 2:205138713-205138735 CTGTATATATGAATGGGAATGGG + Intronic
945304793 2:208249022-208249044 CAATATTTACTAAGGGAAAAAGG - Intronic
945629707 2:212258588-212258610 ATATATTTTTAAAGAGAAATTGG - Intronic
948007606 2:234623307-234623329 CTCCATTAATGAAGAGAAATGGG + Intergenic
948297583 2:236874116-236874138 CTATATCTATGAAGAGATGTTGG - Intergenic
1169427165 20:5505254-5505276 CTATATATATGTAGAGAAAGGGG + Intergenic
1170876033 20:20251040-20251062 CTATATTCTTGAAGTAAAATGGG + Intronic
1175169110 20:57067540-57067562 ATATATGTATGAAGAGGAATTGG + Intergenic
1177036789 21:16054638-16054660 ATATACTTATGAAGGAAAAGGGG + Intergenic
1183033923 22:35126541-35126563 CTATATTTATTATGTGAGATGGG + Intergenic
1183487306 22:38095848-38095870 CTAAATTAATAAAGGGAAAAGGG + Intronic
1184328973 22:43813570-43813592 CTATAATAAAGAAGGCAAATGGG - Intergenic
1184945694 22:47802252-47802274 CTTTAGTTGTGAAGGGAAACAGG - Intergenic
949750936 3:7351985-7352007 ATATATTTATCAGGGGGAATTGG - Intronic
950243246 3:11391099-11391121 GTATATTCAGGAAAGGAAATGGG - Intronic
950602194 3:14044777-14044799 CTATATTTATCAAGGGCTCTGGG + Intronic
951564722 3:24002004-24002026 GTATATTTATTATGGGAATTGGG + Intergenic
955384179 3:58465918-58465940 AAATGTTTATAAAGGGAAATCGG + Intergenic
956099971 3:65757897-65757919 CTCTATTGTTTAAGGGAAATTGG - Intronic
957154837 3:76534406-76534428 CTATTCATATGATGGGAAATGGG - Intronic
959227242 3:103601465-103601487 CTTTATTTACTAAGGAAAATGGG - Intergenic
959330518 3:104998659-104998681 CTTTATTTATGAAGGTTAGTTGG - Intergenic
959663481 3:108895711-108895733 CTGAAGTGATGAAGGGAAATTGG + Intergenic
959765328 3:110020384-110020406 CCATATTTTTGAATGGAACTTGG + Intergenic
960510778 3:118546521-118546543 CTATAATTGTGAGAGGAAATTGG - Intergenic
960771938 3:121203301-121203323 AAAGATTTGTGAAGGGAAATAGG - Intronic
962229677 3:133651490-133651512 TTATTGTTAAGAAGGGAAATTGG - Intronic
962453092 3:135538249-135538271 CATTATTTAAGATGGGAAATAGG - Intergenic
962863119 3:139423040-139423062 TTATACTTATGGAGAGAAATAGG - Intergenic
963195128 3:142518946-142518968 ATATATTCATGAGGAGAAATTGG + Intronic
963313186 3:143730687-143730709 CGAAATTTATGAAGATAAATTGG - Intronic
963557987 3:146819929-146819951 CTATATTTATACAGGTAAACTGG - Intergenic
965427673 3:168547233-168547255 CCATGTTTGTGAAGGGAAAGTGG + Intergenic
965566403 3:170123486-170123508 TTATACTTAAGAAGGAAAATGGG + Intronic
966441970 3:179955304-179955326 GTATAGTTTTGAAGGGAATTAGG - Intronic
968437019 4:598659-598681 CTATATTTCTGAAGTAAGATAGG - Intergenic
969987262 4:11225264-11225286 ACATATTTGTGAAAGGAAATGGG + Intergenic
970534666 4:17018304-17018326 GAATATGTAAGAAGGGAAATTGG + Intergenic
971724422 4:30291392-30291414 TTATATTCATGAAGGAAAATGGG - Intergenic
971839990 4:31838566-31838588 CTATATTTCTTTAGGGAACTAGG - Intergenic
972796586 4:42427310-42427332 CTATTCTTATGAAGATAAATGGG - Intronic
973080278 4:45982839-45982861 CAATATTTATGAACAGAAAAGGG - Intergenic
974132736 4:57776683-57776705 TTAAATTTATAAAGGGAAAGTGG - Intergenic
974311721 4:60219865-60219887 CTATAATTATAAAGGAAAAGTGG + Intergenic
976316751 4:83666860-83666882 CTCTGTTTATGAATGGAAGTGGG + Intergenic
976437805 4:85038839-85038861 GTATTTTTATACAGGGAAATTGG - Intergenic
977680392 4:99792449-99792471 CTTTATTGGTGAATGGAAATAGG - Intergenic
978636483 4:110813927-110813949 CCATATTTAGGAAAGTAAATAGG + Intergenic
980397303 4:132231164-132231186 CTAAATTTATCAAAGGAGATTGG - Intergenic
981332643 4:143530552-143530574 GCATATTTATGATGGGAAAAAGG + Intronic
981881758 4:149621937-149621959 ATACATATATGAAGGAAAATTGG - Intergenic
983765130 4:171470405-171470427 TTATATTTATAAAGAAAAATAGG + Intergenic
983804832 4:171981954-171981976 CTATATTTCAGAAGTCAAATTGG + Intronic
983878795 4:172909414-172909436 CGTTATTTATGAAGGGTATTAGG - Intronic
984016565 4:174433955-174433977 CTATATTGATGAATGGCATTTGG - Intergenic
984513845 4:180713881-180713903 CTGTATTCATGAACGGAAATGGG - Intergenic
984853096 4:184170555-184170577 ATTTATTTATGGAGGGAACTGGG + Intronic
985925387 5:3012044-3012066 CTATATTTATCAAGGTAACAAGG - Intergenic
987633124 5:20502807-20502829 CTACATTTATAAAGGAGAATTGG + Intronic
987893542 5:23915406-23915428 CTAGAATTATGCAAGGAAATTGG + Intergenic
988017217 5:25574691-25574713 CTATACTTATGGAGATAAATTGG + Intergenic
988029483 5:25744565-25744587 TAATATTTATAAAGGCAAATAGG - Intergenic
988051592 5:26038020-26038042 CTGTATTAATGAAGGGCAATGGG - Intergenic
989832234 5:45934308-45934330 CAGTATCTTTGAAGGGAAATTGG + Intergenic
990072994 5:51807928-51807950 CTATATTTATGAAAGAAGGTGGG - Intergenic
991719115 5:69479404-69479426 CTATACTGATGAAGGGAAGAAGG + Intergenic
992378376 5:76212233-76212255 CTATGTTTAAGAAGGTGAATAGG + Intronic
993591288 5:89798452-89798474 TTATAGTCATTAAGGGAAATTGG - Intergenic
995159779 5:108966216-108966238 ATAAATATTTGAAGGGAAATGGG + Intronic
995519373 5:112987223-112987245 CTATATTTTTGAGGGAATATAGG + Intronic
995546228 5:113234610-113234632 CTGTATTTTTAAAGGGAAATTGG - Intronic
995787908 5:115850292-115850314 ATATATTAATGACAGGAAATAGG - Intronic
996322396 5:122233281-122233303 GTGTATTTCTGAAGGAAAATTGG + Intergenic
997084463 5:130781645-130781667 GTATATTTATAGAGGGAAGTTGG + Intergenic
999123904 5:149232002-149232024 CTTTGTTTAAAAAGGGAAATTGG + Intronic
999666805 5:153921287-153921309 CTTCATAAATGAAGGGAAATGGG - Intergenic
1000471707 5:161651383-161651405 CCATATTAATGAAGTAAAATAGG - Intronic
1001542307 5:172548110-172548132 CTATATTTGGGAAGGGGAGTTGG + Intergenic
1001735928 5:174001340-174001362 CTGTATTTAAGAAAGGAAATAGG - Intronic
1001828460 5:174765405-174765427 CTCTATTTTTGGAAGGAAATTGG + Intergenic
1003744481 6:8984563-8984585 TTATTTTTATGAAGGATAATTGG + Intergenic
1005117912 6:22358176-22358198 CTATATTGCTGCAGGCAAATAGG - Intergenic
1007901515 6:45418466-45418488 GAATATTTCTGAAGAGAAATAGG + Intronic
1009793481 6:68435122-68435144 ATATATTTAAAAAGGCAAATTGG - Intergenic
1011758477 6:90531182-90531204 CTATATTTATAAAAAGGAATTGG + Intronic
1011792041 6:90908939-90908961 ATATTTTTATGTGGGGAAATAGG + Intergenic
1012319914 6:97830289-97830311 CTATAGTTATGATGGGTAAGTGG - Intergenic
1012770080 6:103421754-103421776 CTATATTTATGAATATAAATTGG + Intergenic
1012830096 6:104193568-104193590 CTATGTTAATCAAGGGATATTGG - Intergenic
1013160118 6:107535073-107535095 CTATAATTCTGAAGGGTTATGGG + Intronic
1013848873 6:114489461-114489483 CTAAATTGATAAATGGAAATTGG - Intergenic
1014211152 6:118709492-118709514 TTATCTTTATGAGAGGAAATGGG - Intronic
1014478824 6:121909617-121909639 CTGTATTTATAAAGTGAATTTGG + Intergenic
1015149917 6:130025493-130025515 CTTGATTTATGAAGTAAAATTGG + Intronic
1016608591 6:145963505-145963527 CTATGTTTATGAACGAAGATAGG - Intronic
1017209966 6:151844703-151844725 CTTTATTTATGGAAGGGAATAGG + Intronic
1020561284 7:9730644-9730666 CTATATTTGTGCAGGGCATTTGG - Intergenic
1020634599 7:10681428-10681450 CTATATTTAAGAGGGAGAATGGG - Intergenic
1020896976 7:13952539-13952561 CTATATTTAAGAAGGGAGGGAGG + Intronic
1021105263 7:16631338-16631360 CTGTATTTATAAAGTGAATTGGG + Intronic
1021344195 7:19503655-19503677 CTATATTAATGAAGGCAATATGG + Intergenic
1022287863 7:28972714-28972736 CAAGCTTTTTGAAGGGAAATTGG - Intergenic
1023028515 7:36073441-36073463 GTCTATTTTTGAATGGAAATGGG - Intergenic
1024776227 7:52789606-52789628 TTTTATTTATGAAGTAAAATTGG + Intergenic
1024945105 7:54800272-54800294 AAATAATAATGAAGGGAAATTGG - Intergenic
1025534787 7:61934225-61934247 ATGTATTTGTGAAGGGACATTGG + Intergenic
1026567240 7:71499676-71499698 CTGTATAGATGAAGAGAAATCGG - Intronic
1027135756 7:75622895-75622917 ATATATTTTTTAAAGGAAATTGG + Intronic
1028342331 7:89736658-89736680 CTAGATTTAGGAACCGAAATGGG + Intergenic
1028474078 7:91234721-91234743 TTTTATTAATGGAGGGAAATTGG - Intergenic
1028966082 7:96802962-96802984 ATATCTTTTTGAAGGGACATTGG + Intergenic
1030016221 7:105224786-105224808 CTAAATTCATGAAAGAAAATAGG - Intronic
1030579754 7:111339439-111339461 ATATATTTATGTAGGGTATTAGG - Intronic
1032099637 7:128963198-128963220 GTTTATTTATCAAGTGAAATAGG - Intronic
1032480324 7:132240852-132240874 ATATATTTCTTAAGGGAATTTGG + Intronic
1033937178 7:146601072-146601094 ATATATTTAAAAAAGGAAATGGG - Intronic
1034152488 7:148928038-148928060 CTAAATTTAAAAAGGGAATTGGG + Intergenic
1037172309 8:15907570-15907592 CGGTATTTATTAAGGAAAATGGG - Intergenic
1039318452 8:36399791-36399813 CTCTTTTTATGAAGGAATATTGG - Intergenic
1039882931 8:41637470-41637492 CTATATTTATGAATAGAATGAGG - Intergenic
1045164138 8:99583929-99583951 CTGTATTTAGGAAAGGAGATGGG + Intronic
1045365114 8:101468915-101468937 CTCTATTTACAAATGGAAATTGG - Intergenic
1046291600 8:112169419-112169441 CTATATTTATTTAGGGAGCTAGG + Intergenic
1046367238 8:113250886-113250908 CCATATTTATGAATAGAATTGGG + Intronic
1046389234 8:113546626-113546648 GTATCTTTAAGAAGAGAAATAGG - Intergenic
1046862321 8:119107221-119107243 ATATATTTATGAAGAGTAAAAGG - Intergenic
1047607691 8:126491168-126491190 CAATATCTGTGATGGGAAATAGG + Intergenic
1048196160 8:132333466-132333488 TTATGTTTATAAAGGGAAATCGG - Intronic
1048794356 8:138135594-138135616 CAATATTTTAGAAGGGAATTTGG + Intronic
1050785079 9:9390369-9390391 ATATACTTATTAAGAGAAATGGG + Intronic
1051680115 9:19598761-19598783 TTATATTTATGAAGGTATTTAGG - Intronic
1051797236 9:20886157-20886179 CTAAATATATGAAAGGAAAATGG - Intronic
1052917528 9:33935033-33935055 CTTTATTCAGGAAGGCAAATGGG - Intronic
1053464910 9:38298892-38298914 TTATATTTAAAAAGGGAAAAAGG + Intergenic
1055958393 9:81795803-81795825 CTATAATTCTCAAGGGAAAATGG - Intergenic
1056009622 9:82313543-82313565 CTTTCTTTATGAAGAGAAAAAGG - Intergenic
1057894245 9:98894424-98894446 TTACATTTATGAAGGGCAGTAGG + Intergenic
1057998413 9:99841473-99841495 CCATATTTATGAAATGGAATGGG - Intronic
1058447057 9:105063920-105063942 CTTTGTTTATGAAGGGAATGGGG - Intergenic
1058601032 9:106670563-106670585 AAATATTTATGAAGGAAAATTGG - Intergenic
1058762561 9:108149289-108149311 CTATGTTTATGAAGGGGGCTGGG - Intergenic
1059784513 9:117565863-117565885 CTATATTCTTGTAGGGAAGTTGG + Intergenic
1186068566 X:5792646-5792668 ATAGATTTATTAAGAGAAATTGG - Intergenic
1188038079 X:25340753-25340775 CTTTCTTTATGAAGGGCAAAGGG - Intergenic
1188148436 X:26643285-26643307 CAAAATTTATGGAAGGAAATTGG - Intergenic
1188278422 X:28231742-28231764 CTATGGTGAAGAAGGGAAATTGG - Intergenic
1188618377 X:32188511-32188533 CACTATTTATTAAGTGAAATAGG + Intronic
1188748517 X:33876719-33876741 CTATATTTAAAAAGGAAAGTAGG - Intergenic
1188938086 X:36202211-36202233 CTATTTTTATGATTGGAATTAGG + Intergenic
1191624796 X:63258888-63258910 CTATATCTATGGAGATAAATTGG - Intergenic
1191905386 X:66082480-66082502 CTATAATTGTTAAAGGAAATAGG - Intergenic
1192850328 X:74949078-74949100 CTATTTTTGTTAAGTGAAATGGG - Intergenic
1193754576 X:85392128-85392150 CAATATTTATGAACAGAAAAAGG - Intergenic
1194100820 X:89701591-89701613 CTTTCTTTATGAAGGCATATAGG - Intergenic
1194252417 X:91592488-91592510 ATATAATTAGGAAGGGAAATAGG - Intergenic
1195326264 X:103761078-103761100 CTATATATATGAACAGAGATGGG + Intergenic
1196832032 X:119783371-119783393 CCATATCTATGAAGGGAGTTGGG - Intergenic
1197837591 X:130711976-130711998 CTACATTTATGAAGGCAACAAGG + Intronic
1199447025 X:147937119-147937141 ATATATTTATGAAGATAAAAGGG - Intronic
1200308264 X:155051121-155051143 CTGTTTTTATCAAGGGAAATAGG + Intronic
1200453774 Y:3362678-3362700 CTTTCTTTATGAAGGCATATAGG - Intergenic
1200571348 Y:4833732-4833754 ATATAATTAGGAAGGGAAATAGG - Intergenic
1202097255 Y:21264543-21264565 CTAAATTTCTCAGGGGAAATTGG - Intergenic