ID: 1158649416

View in Genome Browser
Species Human (GRCh38)
Location 18:59272937-59272959
Sequence CGCCGGGGCTGGCGGCGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1178
Summary {0: 1, 1: 1, 2: 8, 3: 112, 4: 1056}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158649400_1158649416 14 Left 1158649400 18:59272900-59272922 CCAGGGGTGCGCACTCACCTTCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1158649416 18:59272937-59272959 CGCCGGGGCTGGCGGCGGGGAGG 0: 1
1: 1
2: 8
3: 112
4: 1056
1158649407_1158649416 -3 Left 1158649407 18:59272917-59272939 CCTTCGTACTCGGGGGCGGGCGC 0: 1
1: 0
2: 1
3: 5
4: 26
Right 1158649416 18:59272937-59272959 CGCCGGGGCTGGCGGCGGGGAGG 0: 1
1: 1
2: 8
3: 112
4: 1056
1158649399_1158649416 24 Left 1158649399 18:59272890-59272912 CCTCGCACAGCCAGGGGTGCGCA 0: 1
1: 0
2: 1
3: 17
4: 146
Right 1158649416 18:59272937-59272959 CGCCGGGGCTGGCGGCGGGGAGG 0: 1
1: 1
2: 8
3: 112
4: 1056

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158649416 Original CRISPR CGCCGGGGCTGGCGGCGGGG AGG Exonic
900088722 1:910106-910128 CGGCGGGGATGGGGGTGGGGGGG + Intergenic
900092191 1:925333-925355 CGGCGGGGGAGGCTGCGGGGCGG + Intronic
900102374 1:967374-967396 CACAGGGGCTGGGGGGGGGGTGG - Intronic
900117606 1:1035154-1035176 CCCTGGGGCTAGCGGTGGGGGGG + Intronic
900145550 1:1157461-1157483 GGGCGGGGCTGCGGGCGGGGCGG - Intergenic
900174617 1:1286284-1286306 GGCCAGGGCTGTCGGCGGGAGGG + Intronic
900201042 1:1406709-1406731 CAGTGGGGGTGGCGGCGGGGCGG + Intronic
900346395 1:2212512-2212534 GGCCGGGGGTGGGGGTGGGGGGG - Intronic
900349742 1:2228683-2228705 CGCCGGGGCGCGCGGGGCGGCGG + Exonic
900394183 1:2446395-2446417 TCCCGGGGCTGGGGGTGGGGTGG + Intronic
900395552 1:2451813-2451835 CGTCTGGGCTGCCGGGGGGGCGG + Intronic
900419661 1:2550392-2550414 GGCCAGGGCTGAGGGCGGGGAGG + Intergenic
900425562 1:2576878-2576900 GGCCAGGGCTGAGGGCGGGGAGG - Intergenic
900497152 1:2980921-2980943 AGCTGGGGGTGGGGGCGGGGGGG + Intergenic
900502338 1:3012608-3012630 GGCCTGGGGAGGCGGCGGGGTGG - Intergenic
900562388 1:3313718-3313740 CGCCGGGGCAGGAGGCGGCGAGG - Intronic
900582130 1:3414508-3414530 CGGCGGGGCGGGCGGCTCGGTGG + Intronic
900948829 1:5846130-5846152 GGCCTGAGCTGGCGGCTGGGGGG + Intergenic
901063841 1:6485670-6485692 CGCCCGGGCAGGCGGAGGCGGGG - Intronic
901162140 1:7186638-7186660 TGCCGGGGCTGGTTGGGGGGAGG + Intronic
901192684 1:7421961-7421983 CGCCGTGGCTGGGGGAGTGGAGG + Intronic
901199166 1:7457039-7457061 CGGCGGCGCAGGGGGCGGGGCGG - Intronic
901433876 1:9234713-9234735 CGGCGGGGGCGGGGGCGGGGCGG - Intergenic
901506574 1:9689438-9689460 GGCCGGGGCCGGCGGCGGCGCGG - Intronic
901556095 1:10032735-10032757 CGCTGGGGCTGCGGGCGCGGCGG - Intergenic
901671274 1:10857743-10857765 TGCTGGGGGTGGGGGCGGGGGGG - Intergenic
901703963 1:11059901-11059923 CGGCGGGGCCGGAGGCGGCGGGG + Exonic
901741687 1:11345930-11345952 CACCGGGGCTGGGGAAGGGGTGG + Intergenic
902273473 1:15323279-15323301 AGCTGGGGCTGGGGGCGGGGAGG + Intronic
902415614 1:16237044-16237066 CGCCGGGACTGCTGACGGGGAGG - Exonic
902807711 1:18871528-18871550 GGCCGGGGCAGGTGGCTGGGTGG - Exonic
902896905 1:19485484-19485506 CGCCGGGCCCTGCTGCGGGGGGG - Exonic
903044009 1:20552672-20552694 GGCCGGGGCTGGGGGTGAGGTGG - Exonic
903247741 1:22028544-22028566 AGCCGTGGGGGGCGGCGGGGCGG - Intergenic
903251024 1:22053083-22053105 CGCCGGGCCGGGCTGGGGGGAGG - Intronic
903349989 1:22711413-22711435 GGCCGTGGCGGGGGGCGGGGGGG + Intronic
903663417 1:24992573-24992595 TGCCGGGGATGGAGGTGGGGTGG + Intergenic
903777071 1:25800161-25800183 GGGCGGGGCCGGGGGCGGGGCGG - Exonic
903907562 1:26697065-26697087 GGCCGGGGCGGGCGGGGGGTAGG - Exonic
904587597 1:31588755-31588777 GGCTGGAGGTGGCGGCGGGGAGG - Intergenic
904609057 1:31715212-31715234 AGGCGTGGCTGTCGGCGGGGTGG - Intergenic
904724923 1:32539790-32539812 GGCCGGGCCGGGCGGCGAGGCGG - Intronic
906062534 1:42958184-42958206 CGCCGGGGCCGGGGCCGGGCCGG + Intronic
906076915 1:43058635-43058657 CGCTGGGGCTGGGGCTGGGGCGG + Intergenic
906157433 1:43622014-43622036 CGGCGGGGGTGGCGGAGGAGAGG - Exonic
906270441 1:44473488-44473510 GGCGGGGGCGGGGGGCGGGGCGG + Intronic
906532158 1:46530189-46530211 CCCAGGGCCTGGGGGCGGGGGGG - Intergenic
906615769 1:47232012-47232034 GGCCGGGGGGGGCGGTGGGGGGG - Intronic
907341246 1:53737971-53737993 CGCCGAGGCTGGCGGGGCCGCGG + Intergenic
907880609 1:58546476-58546498 CGCCGGGGCGGGAGACGGAGGGG - Intronic
908293151 1:62688090-62688112 CGGCCTGGCTCGCGGCGGGGCGG - Intronic
908501113 1:64744906-64744928 CGCCGGGGCCGGGGGCCGGCGGG + Intergenic
909001372 1:70221456-70221478 CCCCGCGGCGTGCGGCGGGGCGG + Intronic
909433600 1:75616242-75616264 CACCGGGGGTGGGGGCGTGGGGG - Intergenic
910237010 1:85047441-85047463 CGCCGGCGCGGGAGGCAGGGTGG + Intronic
910981223 1:92961509-92961531 CGGCCGGGCAGGGGGCGGGGAGG - Intronic
911115005 1:94237624-94237646 GGGCGGGGCTGGCGGGCGGGCGG - Intronic
911188721 1:94927323-94927345 CACCGGGGCCGGCGGCTAGGCGG + Intergenic
911852437 1:102836417-102836439 CACCGGGGCTTGTGGCAGGGTGG + Intergenic
912194001 1:107376809-107376831 TGCTGGGGCTGGTGGCTGGGGGG - Intronic
912212583 1:107570989-107571011 CCACGGGGCTGGCGGGCGGGGGG + Intergenic
912386499 1:109273561-109273583 TGCCGGGGCGGTGGGCGGGGAGG - Exonic
912798548 1:112707047-112707069 GGCCGGGGCTGCGGGCGGTGGGG - Intronic
913022905 1:114804967-114804989 GGCCAGGGCAGGCGGCTGGGAGG + Intergenic
913047969 1:115089590-115089612 CGGCGTGGCTGGCGACGGGTGGG + Intergenic
913222027 1:116667556-116667578 CCCCGGGGAGGGAGGCGGGGAGG - Intronic
913410746 1:118548448-118548470 CACCGGGGCTGTTTGCGGGGTGG + Intergenic
914197332 1:145454423-145454445 CGGCGGGGCCGGCGGGGCGGGGG - Intergenic
914255985 1:145961483-145961505 CGCCGGGGGTGGGGGCGCCGCGG - Exonic
914264658 1:146028046-146028068 GGCCGAGGCAGGCGGCCGGGAGG - Intergenic
914993094 1:152515457-152515479 CGCCGGGGTGGGCGCCGGGGCGG - Exonic
915463191 1:156081738-156081760 CGCCGCGGGCGGCGGCGGCGGGG + Exonic
915463199 1:156081753-156081775 CGGCGGGGCCGGCTGCGGGGGGG + Exonic
915549856 1:156625540-156625562 CGGCTGGCCCGGCGGCGGGGAGG + Exonic
915951030 1:160190196-160190218 AGCTGGGGCTGGGGGAGGGGAGG - Intergenic
916037242 1:160933020-160933042 GGCCGAGGCAGGCGGCTGGGAGG - Intergenic
916107281 1:161441211-161441233 CGCCGGGGCAGGAGGAGGCGCGG + Intergenic
916108868 1:161448629-161448651 CGCCGGGGCAGGAGGAGGCGCGG + Intergenic
916110456 1:161456010-161456032 CGCCGGGGCAGGAGGAGGCGCGG + Intergenic
916112041 1:161463420-161463442 CGCCGGGGCAGGAGGAGGCGCGG + Intergenic
916113628 1:161470801-161470823 CGCCGGGGCAGGAGGAGGCGCGG + Intergenic
916666997 1:166975598-166975620 CGCGGCAGCGGGCGGCGGGGCGG - Intronic
916802186 1:168225964-168225986 CGCCGCGGTTGGCGCCTGGGCGG + Intronic
916890258 1:169106615-169106637 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
917291579 1:173477186-173477208 GGGCGGGGCTGGGCGCGGGGCGG - Intergenic
917345265 1:174022437-174022459 AGGCGGGGCGGGCGGAGGGGAGG + Intergenic
917869464 1:179229180-179229202 GGCCGGGGGTGGGGTCGGGGCGG - Intronic
918215807 1:182391461-182391483 CGTCGGGGCTGGCGCTGGTGGGG - Intronic
919678335 1:200409415-200409437 GTCCGGGGCTGGCGGAGGGGGGG + Exonic
919744531 1:201000265-201000287 CCCTGGGGCTGGGGGCGTGGAGG + Intronic
920022683 1:202967339-202967361 GGCGGGGCCTGGCGGGGGGGGGG + Intergenic
920222214 1:204412044-204412066 AGCCGGGGCGGGGGGGGGGGGGG + Intergenic
921206774 1:212856232-212856254 GGCCGGGGCGGGCGGAGGGGGGG + Intergenic
921355590 1:214281529-214281551 CGCCGGCCCTTGGGGCGGGGTGG + Intronic
922315056 1:224434619-224434641 CGCCGGGGGGCGCCGCGGGGCGG + Intronic
922460277 1:225810242-225810264 CGCCGGGGTGGGCGGCGGGCCGG + Intronic
922612451 1:226940416-226940438 CGCCTGGGCACGCGGCGGGCCGG - Intronic
922739364 1:228006869-228006891 CGCCGGGGCCGGGGCCCGGGCGG - Intergenic
922821164 1:228486868-228486890 CGCGTGGGCTGGGGACGGGGCGG - Intergenic
922821286 1:228487472-228487494 CGCCAGGGCTGCGGGCGGCGGGG - Exonic
922937130 1:229431685-229431707 TGCGCGGGCTGTCGGCGGGGTGG - Intronic
923056102 1:230426492-230426514 GGCCGGGGCTGGCGGTTAGGGGG + Intergenic
923057566 1:230438648-230438670 AGGCGGGGCTGGCTTCGGGGTGG + Intergenic
923086301 1:230705864-230705886 TGCCCAGGCTGGGGGCGGGGTGG - Intronic
923372653 1:233328328-233328350 GCGCGGGGCTGGCGGCCGGGCGG - Exonic
924242833 1:242057135-242057157 CGCCAAGGTTGGCGGTGGGGGGG + Intergenic
924415008 1:243849923-243849945 GGCGGGGGATGGCGGCGGGGTGG - Intronic
924436583 1:244048643-244048665 CGCCGGGCCGGGTGGGGGGGCGG - Intergenic
924482634 1:244451307-244451329 CGCCGGGACTGAGGCCGGGGTGG - Intronic
924801607 1:247332302-247332324 GGCTTCGGCTGGCGGCGGGGGGG - Intergenic
1063194388 10:3727659-3727681 AGCCGGAGCTGGGGGCGGTGGGG + Intergenic
1063671527 10:8103382-8103404 GCCCGAGGCTGGAGGCGGGGGGG + Intergenic
1064060100 10:12129843-12129865 CGCCTGGGCTGCGGGCGGTGGGG + Intronic
1064231005 10:13529115-13529137 CCCCGGGGATGGCGGCGGCCGGG - Intergenic
1064443060 10:15370896-15370918 CGCCGGGCCTGGCGCGGAGGCGG - Intronic
1064552782 10:16520452-16520474 AGCGCGGGCGGGCGGCGGGGAGG - Intronic
1065024230 10:21526121-21526143 CGCCGGGGCAGTCGGGGTGGGGG - Intergenic
1065099102 10:22316311-22316333 CGGGGCGGCTGGCGGCGGCGCGG - Exonic
1065342874 10:24723352-24723374 AGCAAGGGCGGGCGGCGGGGCGG - Intronic
1065619402 10:27565027-27565049 GCCAGAGGCTGGCGGCGGGGAGG - Intergenic
1065712873 10:28533653-28533675 GGCGGGGGGCGGCGGCGGGGGGG + Intronic
1065727941 10:28684396-28684418 CGGCGGGGCAGGGGGCAGGGTGG - Intergenic
1066464226 10:35639497-35639519 CGCGGGGGGTGGCGGCGGGCCGG - Exonic
1068103842 10:52590333-52590355 CTCTGGGGCTGGGGGTGGGGTGG + Intergenic
1068566936 10:58586521-58586543 AACCGGGGTTGGGGGCGGGGGGG + Intronic
1068956022 10:62818946-62818968 GACCGGGGCTGGGGGCGGGGCGG + Intronic
1069372644 10:67763987-67764009 CGAGGGGGCGGGCGGGGGGGGGG + Intergenic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1069818400 10:71212876-71212898 CGCCGGGGAGGACGGCGAGGAGG + Exonic
1069829991 10:71277197-71277219 CCCCGGGGCTGGGGGTGGTGCGG + Intronic
1070162521 10:73874611-73874633 GGGCGGGGCGGGCGGCGCGGGGG - Intergenic
1070162531 10:73874628-73874650 GGCGGGGCCTGGGGGCGGGGCGG - Intergenic
1070256062 10:74813950-74813972 AGGCGGGGGTGGGGGCGGGGTGG - Intergenic
1070756440 10:78996526-78996548 CGCTGGGGGTGGGGGCGGAGGGG - Intergenic
1070757363 10:79001665-79001687 GGCAGTGGCTGGCGGTGGGGTGG + Intergenic
1071298096 10:84237228-84237250 CGCCTGGGGTGGTGGCCGGGAGG + Exonic
1071309368 10:84328531-84328553 CGCACGGGCCCGCGGCGGGGCGG + Intergenic
1071544853 10:86521557-86521579 CGGCGGCGCTCGAGGCGGGGAGG - Exonic
1071695286 10:87863506-87863528 CGCCCGGGCTCCCGGCGCGGCGG + Exonic
1072169787 10:92848411-92848433 CGCTCGGGCCGGCGGCGCGGGGG - Intronic
1072253698 10:93601131-93601153 CCTCGGGGCCGGCGGCGGGATGG - Intronic
1072591518 10:96832423-96832445 CGGCGGGGCGGCCGGAGGGGCGG - Intronic
1072926280 10:99620200-99620222 CCGGGGGGCCGGCGGCGGGGAGG - Exonic
1073094090 10:100969491-100969513 GGCCGCGGCTGGAGGCGGGGCGG - Intronic
1073094834 10:100973067-100973089 AGCCAGGGCTGGGGGTGGGGAGG + Intronic
1073156891 10:101354331-101354353 GGCCGAGGCTGGCGGCGGAGCGG + Intronic
1073212660 10:101817875-101817897 CGCCGGGGCTGGGGGAGCGGCGG - Exonic
1073330492 10:102667387-102667409 AGCCGGGCGTGGTGGCGGGGCGG + Intergenic
1073403682 10:103278282-103278304 GGCCGGGGCTGGGCGTGGGGAGG + Intronic
1074484922 10:113866737-113866759 AGCCGGGGGTGGAGGCGGGGAGG - Intronic
1074532289 10:114305802-114305824 CGTCGGGGCTGCAGGAGGGGAGG + Intronic
1074595836 10:114866127-114866149 GGCCTGTGCTGGGGGCGGGGTGG - Intronic
1074618689 10:115094206-115094228 CCCCGGGGCTGGAGGGGGCGCGG - Intronic
1075031945 10:119029755-119029777 GGCCCGCGCCGGCGGCGGGGAGG + Exonic
1075207061 10:120457145-120457167 GGCGGGGGCAGGCGCCGGGGAGG - Exonic
1075370176 10:121928497-121928519 CGCTGGGGCCCGCGGCGGGAGGG + Intronic
1075748270 10:124743381-124743403 CGCTGGGGCTTGCGGAGTGGGGG - Intronic
1076117024 10:127907631-127907653 CGCGGGGGCCGGCGGCAGGGCGG + Intronic
1076373845 10:129970913-129970935 CGCCGGGGCTGGAAGGGGGAGGG + Intergenic
1076650243 10:131982240-131982262 CGCCGCGGCGGGCGGTGGGCCGG + Intergenic
1076722094 10:132397179-132397201 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1076835029 10:133016711-133016733 CTCAGGGGCTGGCAGTGGGGAGG - Intergenic
1076874738 10:133210583-133210605 GGGCGGGGCGGGCGGCGGTGAGG - Intronic
1076916009 10:133423456-133423478 CGCCGGGGCGGCAGCCGGGGCGG - Exonic
1076948263 10:133665856-133665878 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
1076949252 10:133669166-133669188 CGCAGGGACTGGGGGCGGGCGGG + Intronic
1076950236 10:133672465-133672487 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
1076951221 10:133675764-133675786 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
1076952211 10:133679074-133679096 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
1076953199 10:133682384-133682406 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
1076955167 10:133742035-133742057 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
1076956157 10:133745345-133745367 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
1076957145 10:133748654-133748676 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
1076958134 10:133751964-133751986 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
1076959118 10:133755263-133755285 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
1076960107 10:133758573-133758595 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
1077011536 11:381296-381318 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1077011551 11:381328-381350 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1077011580 11:381392-381414 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1077011609 11:381456-381478 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1077011638 11:381520-381542 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1077011667 11:381584-381606 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1077014746 11:394542-394564 CGGCGGGGATGGCGGTGGCGGGG + Intronic
1077059245 11:610511-610533 GGCCGGGGCAGGCGGCAGGCCGG - Exonic
1077076869 11:706023-706045 AGGCGGGGCAGGGGGCGGGGCGG + Intronic
1077121505 11:910947-910969 GGCCGGGGCCGGGGCCGGGGCGG + Intronic
1077204664 11:1336699-1336721 GGGCGGGGCGGGCGGGGGGGCGG + Intergenic
1077225093 11:1436155-1436177 AGGCGGGGCCGGCGGTGGGGTGG + Intronic
1077285631 11:1764050-1764072 CGCCCGGGCGGGGGGCGGGGTGG + Intergenic
1077302703 11:1854623-1854645 GGCCGGGGCTGGCTGAGGGCTGG + Intronic
1077360347 11:2138000-2138022 CGGCGGAGCTGGGGGTGGGGTGG - Intronic
1077483213 11:2826288-2826310 AGCCGGGGTTGGGGGCGGGGAGG + Intronic
1077495564 11:2885031-2885053 GACCGGGACTGGGGGCGGGGTGG + Exonic
1078090809 11:8263282-8263304 CGCCGCGGCAGGGGGCGAGGGGG + Intronic
1078175031 11:8964054-8964076 GGGCGGGGCTGGTGGCGGCGGGG + Intronic
1078180196 11:9004443-9004465 AGCCCCGGCTGGCGGCGTGGAGG - Intergenic
1078514148 11:12008680-12008702 GCCAGGGGCGGGCGGCGGGGCGG - Intronic
1079555140 11:21751369-21751391 CCCCAGAGCTGGGGGCGGGGGGG - Intergenic
1080412879 11:32042828-32042850 CACCGGGGCCTGTGGCGGGGTGG + Intronic
1080489980 11:32751648-32751670 TGCAGGGGCTGGGGGAGGGGTGG + Intronic
1080659865 11:34286928-34286950 TGCCGGGGCTGGGGGAGGGAAGG + Intronic
1080668536 11:34356800-34356822 CGGAGGGGCCGGAGGCGGGGAGG - Exonic
1080789614 11:35510459-35510481 TTCCGGGGGTGGGGGCGGGGAGG - Intronic
1080864110 11:36178328-36178350 CAGTTGGGCTGGCGGCGGGGAGG - Intronic
1081672823 11:44950979-44951001 CGCCGGGGCGGGCGGGATGGGGG + Intronic
1081705575 11:45180656-45180678 TGCCGGGCCTGGCGGGCGGGGGG + Intronic
1081793332 11:45804251-45804273 CCCCGGGGGTGCCGGCGGAGAGG - Intronic
1081804965 11:45885562-45885584 GGGCGGGGCTGGCGGGGTGGGGG + Intergenic
1081869124 11:46375379-46375401 CACCAGGGCTGGGGGCAGGGGGG - Intronic
1081870734 11:46381570-46381592 CGCCGGGGTCGGGGGCGGTGCGG + Intronic
1083185795 11:61017228-61017250 AGCTGGGGCTGGGGGCTGGGGGG + Intronic
1083265758 11:61546198-61546220 CGGCGGGGCTGGCGGTGGAGCGG - Exonic
1083442840 11:62688251-62688273 CGGCGGGTCGGGCGGCTGGGCGG + Exonic
1083743516 11:64723101-64723123 CGGCGGGGCGGGCGGGCGGGCGG - Exonic
1083936587 11:65872806-65872828 CGCCGCGGCAGGCGGGCGGGCGG - Exonic
1083939979 11:65890607-65890629 CGGCGGGGCGCGCGCCGGGGCGG - Exonic
1083997264 11:66278553-66278575 GGCTGGGGCTGGGGGCGGGGTGG + Intronic
1084151341 11:67289284-67289306 GGGCGGGGCGGGCGGCGGAGCGG - Exonic
1084194707 11:67517866-67517888 GGCTGGGGGTGGCGGTGGGGCGG + Intergenic
1084269918 11:68023248-68023270 GGCCGGGGAAGGGGGCGGGGTGG - Intronic
1084330326 11:68426191-68426213 CGTGGGGGCTGGCAGTGGGGTGG + Intronic
1084336491 11:68460847-68460869 CGCCGGAGCAGGCCGCGGCGCGG + Intronic
1084387717 11:68854718-68854740 CGCCGGGGCCGGCAGGGGAGGGG - Intergenic
1084588763 11:70078471-70078493 CGGCGGGCCTGGGCGCGGGGAGG + Exonic
1084611037 11:70203201-70203223 CGCCCTGGCTGGCGGCGCCGCGG - Exonic
1084888132 11:72223849-72223871 GGGCGGGGCGGGCGGCGCGGAGG + Intronic
1085050500 11:73377682-73377704 CGCGGGGGAGGGGGGCGGGGGGG - Intronic
1085119274 11:73956985-73957007 CTCTGGGGATGGCGGCGAGGCGG + Intronic
1085284642 11:75351758-75351780 CGACGCGGCGGGCGGCGGGCGGG - Intergenic
1085360236 11:75878497-75878519 GGCCAAGGCTGGCGGCTGGGAGG + Intronic
1085416501 11:76322053-76322075 CGGCGGGGCAGGCGGGGTGGGGG + Intergenic
1085609413 11:77933583-77933605 GGCCAGGGCAGGCGGCTGGGAGG - Intronic
1085666202 11:78417583-78417605 CTCCGGGGCCTGCGGAGGGGCGG - Intronic
1086437977 11:86800456-86800478 CCCCGAGGCCGGAGGCGGGGCGG + Exonic
1086697676 11:89864118-89864140 CGGCGCGGCTGGGGGTGGGGAGG - Intergenic
1087014622 11:93543236-93543258 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1088223206 11:107591152-107591174 CGGGGCGGCTGGCGGCGAGGAGG - Intronic
1088606849 11:111540946-111540968 GGCGGGGGCTGGTGCCGGGGTGG + Intronic
1089346976 11:117796964-117796986 TGGCGCGGCTGGCGGCGAGGCGG - Intronic
1089359526 11:117876655-117876677 TGGCGGGGCTGGGGGCAGGGCGG + Exonic
1089432651 11:118436557-118436579 CACCGGGGGCGGCGGCGGCGGGG + Exonic
1089520099 11:119057418-119057440 CCCCGGGGCCGGCGCTGGGGAGG - Intergenic
1089527651 11:119107658-119107680 GGCCCGGGCGGGCCGCGGGGAGG - Exonic
1089556263 11:119317257-119317279 CTCCCGGGCTGGCGGCGCCGGGG - Intronic
1089993419 11:122882880-122882902 CGCCGGGGCGGGCGGGGGCCCGG + Exonic
1090072922 11:123560066-123560088 CGCTGGGGCTGCGGGGGGGGGGG - Intronic
1090780267 11:130001885-130001907 CGTCGGGGCTGGCCGGGCGGAGG - Intronic
1090803381 11:130188282-130188304 AGCTGGGGCTGGCTCCGGGGAGG + Intronic
1091434047 12:459977-459999 GTCCGGGGCTGGCGGGGGCGCGG + Intergenic
1091564718 12:1639812-1639834 CCCCGGGACTGGCTGTGGGGCGG + Exonic
1092143587 12:6200233-6200255 GGCGGGGGCGGGGGGCGGGGGGG + Intronic
1092229019 12:6766669-6766691 GGCCGGGGCTGGCGGGGAGCCGG - Exonic
1092256232 12:6928058-6928080 CGCGGGGCCGGGCGGCGCGGCGG + Intronic
1093464844 12:19439374-19439396 CGCCGGGGCGGGGGCGGGGGCGG + Intronic
1093524762 12:20093411-20093433 CACGGCGGCTGGCGGTGGGGAGG + Intergenic
1094041035 12:26122315-26122337 TGCCGCGGCTGCCGCCGGGGCGG + Exonic
1094546855 12:31412402-31412424 CGCAGGGGCTGGGGAGGGGGAGG + Intronic
1095097396 12:38155829-38155851 CGCCTGGCCCGGGGGCGGGGGGG + Intergenic
1095752670 12:45729257-45729279 AGGCGGGGCTGGGGGTGGGGAGG - Intergenic
1095851326 12:46810374-46810396 CACCGGGGCTGTCGGTGGGTAGG + Intronic
1096008932 12:48196753-48196775 GGCCGGGGTTGGGGGGGGGGCGG + Intergenic
1096167343 12:49436530-49436552 CGCCCGGCCAGGAGGCGGGGGGG - Intronic
1096460826 12:51820823-51820845 CGCGGGGGCTGACGGCGTGCTGG - Intergenic
1096489711 12:52006953-52006975 CGGCGGGGCTGGCGGCGGCTGGG - Exonic
1096792587 12:54054245-54054267 TGGCGGGGCTGGGGACGGGGAGG - Exonic
1096983608 12:55743116-55743138 GGCCGGGGCGGGCGGCTGGGGGG - Intergenic
1097262770 12:57728766-57728788 CCCTGGGGCTGGTGGCGGTGGGG + Intronic
1097267640 12:57755286-57755308 GGCCAGGGCAGGGGGCGGGGAGG - Exonic
1098550374 12:71755141-71755163 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1098973463 12:76878891-76878913 CCCCGGGGTTGGCGGCGCCGCGG + Intronic
1099141226 12:78978011-78978033 CGGCGGGGCCGGCGGAGGGAAGG + Intronic
1100260526 12:92928882-92928904 CGCCCGGCCCGGGGGCGGGGAGG - Intronic
1100404711 12:94263201-94263223 TCCCGGGGCCGGGGGCGGGGAGG - Intronic
1100444628 12:94649935-94649957 CGCCGGGACGTTCGGCGGGGAGG + Intronic
1101371962 12:104138341-104138363 GGGCGGGGCCGGGGGCGGGGCGG - Intergenic
1101428362 12:104606160-104606182 CTCTGGGGCGGGGGGCGGGGGGG + Intronic
1101781582 12:107843414-107843436 AGCCGAGGGTGGCGGCGGGAAGG - Intergenic
1103085791 12:118061119-118061141 GGCCGGGGCGGGCGGCGCGGGGG - Intronic
1103386209 12:120534552-120534574 GGCCGGGCCTGGCGGGGCGGAGG - Exonic
1103504228 12:121430519-121430541 GCCTGGGTCTGGCGGCGGGGGGG - Intronic
1103547522 12:121712717-121712739 GGGCGGGGCGGGCGCCGGGGCGG + Intergenic
1103779447 12:123389233-123389255 GGCCGGGCCGGGCGGCGGGAGGG + Intronic
1103899341 12:124295345-124295367 GCCCGGGGCAGGCGGCGGCGGGG - Intronic
1104376194 12:128267113-128267135 GGGCGGGGCCGGGGGCGGGGCGG + Intergenic
1104833413 12:131770850-131770872 TGCCAGGGCTGGGGGAGGGGAGG - Intronic
1104866985 12:131961525-131961547 CCCCGGGGCTGGGGGCGCAGCGG + Exonic
1104885534 12:132104893-132104915 CCCCGGGGCTGGGGGCGCAGCGG + Exonic
1104901094 12:132189884-132189906 GGCCGGGGGAGGCGCCGGGGAGG - Intergenic
1105368580 13:19782990-19783012 CGCCGGCTTTGGCGGAGGGGTGG - Intronic
1105475065 13:20721777-20721799 CGCCGGCGCAGGCGGGGGTGCGG - Exonic
1106157402 13:27171483-27171505 CGCGGGGCCTAGCGCCGGGGCGG - Intronic
1106517128 13:30465288-30465310 CAGCCGGGCGGGCGGCGGGGCGG - Intronic
1106680039 13:31999839-31999861 GGCCGAGGCAGGCGGCTGGGAGG - Intergenic
1107592524 13:41923270-41923292 CACCGGGGCTTGCCGTGGGGTGG + Intronic
1108227531 13:48304176-48304198 CGCCGTGGCGGGGGGCAGGGAGG - Intronic
1108340699 13:49496104-49496126 CGCGGGGGCGGGCGGGCGGGCGG + Intronic
1108350349 13:49585656-49585678 GGCCGGGGCCGGGGCCGGGGCGG - Intergenic
1108406559 13:50108783-50108805 AGCGGGTGGTGGCGGCGGGGCGG - Intronic
1108518276 13:51222578-51222600 CGCCGGGCCGGGCCGCGGGCGGG + Intronic
1110318202 13:74134290-74134312 GGGCGGGGGCGGCGGCGGGGAGG + Intergenic
1110318325 13:74134674-74134696 CGCGGGGGCTTGCGGCGGGAGGG + Intergenic
1111951340 13:94711674-94711696 CGCGGGGGCGGGCGGCGGCCTGG - Exonic
1112475753 13:99729850-99729872 TGCCGAGGCTGGCGGGGGGAAGG - Intronic
1112507852 13:99985568-99985590 TGGCGGGGGCGGCGGCGGGGCGG + Exonic
1112734472 13:102400944-102400966 CGCGGGGGCTGACGGAGGAGCGG + Intronic
1113201066 13:107867594-107867616 CGCGGGGGCGGGCGGCGGCGGGG + Intergenic
1113655913 13:112067733-112067755 CGCCGGGGCGGGCGGCGGCGGGG + Exonic
1113655998 13:112068090-112068112 CGGCGCGGGTGGCGGCGGCGCGG + Exonic
1113724356 13:112587623-112587645 CGCCGGGGCGGGAGGCGGGAGGG - Intronic
1113768223 13:112894055-112894077 GACCGGGGCGGGCAGCGGGGCGG - Intergenic
1113814159 13:113159917-113159939 GGCTGGGGCTGGCGGCCGGCCGG + Intronic
1113981631 13:114281547-114281569 CGCCGCGGCTCGAGGAGGGGCGG + Intergenic
1114031263 14:18583148-18583170 CGCCGGCGCTGGCAGGGGGAGGG - Intergenic
1114458429 14:22872137-22872159 TGCCAGGGCTGGGGGCGGGGAGG - Exonic
1114477848 14:23010264-23010286 CCCCGGAGTTGGGGGCGGGGGGG + Intergenic
1115320759 14:32077162-32077184 GGCCGCCGCTGGTGGCGGGGAGG + Intronic
1115398577 14:32934884-32934906 GGCCGCGGCGGCCGGCGGGGCGG + Intergenic
1115664480 14:35533449-35533471 CTCGGAGGCTGGCGGCGGGCAGG + Intergenic
1115689222 14:35826375-35826397 GGCCCGGGCCGGGGGCGGGGAGG + Exonic
1115754930 14:36520442-36520464 GGCCGGGGGTGGGGGGGGGGGGG - Intronic
1115851837 14:37595396-37595418 CGGCGGGGCGGGAGGCGCGGCGG - Intronic
1116452831 14:45083971-45083993 CGCCCTCGCTCGCGGCGGGGCGG + Intergenic
1116949864 14:50869823-50869845 AGCAGGGGCTGGAGGTGGGGAGG - Intronic
1117368270 14:55052078-55052100 CGTCAGGTCTGGCTGCGGGGCGG + Intronic
1117920261 14:60721596-60721618 CAACTGGGCCGGCGGCGGGGTGG + Intronic
1119236800 14:73026790-73026812 CGGCGGGGGTGGGGGTGGGGTGG - Intronic
1119319063 14:73718778-73718800 TGCGGGCGCTGGCGGCGGTGCGG + Exonic
1119519990 14:75278406-75278428 GGCCGCGGCTGGGGGAGGGGAGG - Intergenic
1119539260 14:75428099-75428121 CGGCGGGGCTGGCGCCGCGGCGG + Intronic
1119932975 14:78566146-78566168 GGCCGGCGTTGGGGGCGGGGTGG - Intronic
1122275210 14:100587438-100587460 GGCCGGGGCTGGCGGGGAGCCGG - Intergenic
1122578781 14:102758273-102758295 TACAGGGGCTGGCTGCGGGGAGG - Intergenic
1122910748 14:104826650-104826672 GGGCGGGGCTGCCGGAGGGGCGG + Intergenic
1122910774 14:104826703-104826725 GGGCGGGGCTGCCGGAGGGGCGG + Intergenic
1122912313 14:104836851-104836873 CGCCGGTGCAGGGGGGGGGGGGG - Intergenic
1122957098 14:105075948-105075970 CGGGAGGGCTGGCGGCTGGGAGG + Intergenic
1123038713 14:105481729-105481751 TGGCGGGGCGGGGGGCGGGGGGG + Intergenic
1202899773 14_GL000194v1_random:28353-28375 CGCCGGCGCAGGCGCCGGGGGGG - Intergenic
1123709972 15:22980160-22980182 CGCCGGGGTTGGGGGGGAGGGGG + Intronic
1124142290 15:27088254-27088276 CGCGGGGGCGGGCGCGGGGGCGG + Intronic
1124439242 15:29674940-29674962 CAGCGGGGCTGGCGGAGGGGCGG - Intergenic
1124477041 15:30044593-30044615 CGCCGGGCCTGGCGGCGGGGGGG - Intergenic
1124641242 15:31397859-31397881 CTTTGGGGGTGGCGGCGGGGGGG + Intronic
1124712964 15:32030448-32030470 CGCGGGGGCGGGCGGGGCGGGGG + Intergenic
1124999380 15:34754775-34754797 CGCCGGGACGAGGGGCGGGGCGG + Exonic
1125114041 15:36067621-36067643 CGTGGGGGGTGGCGGGGGGGGGG + Intergenic
1125536255 15:40442213-40442235 CGCAGGTGGTGGCGTCGGGGAGG + Intronic
1125722257 15:41850985-41851007 AGCGGGGGCTGGAGGCGTGGGGG - Intronic
1126063873 15:44810342-44810364 CGGCGGGGGTGGGGGGGGGGGGG - Intergenic
1126295720 15:47133343-47133365 CGACGGGGCGGCCGGCCGGGCGG - Intergenic
1126340374 15:47634810-47634832 CTTCGGGGGTGGGGGCGGGGTGG + Intronic
1126876499 15:53047440-53047462 TGCCAGGGCTGGTGGAGGGGAGG - Intergenic
1127224989 15:56918942-56918964 CGGCGGGGCTGGGGGCTGCGGGG + Intronic
1127274276 15:57428452-57428474 CACCGGGGCTGGCCTCGTGGAGG + Intronic
1127931658 15:63601043-63601065 CCCCGGGGGCAGCGGCGGGGCGG - Intronic
1128120680 15:65143843-65143865 AGCCGGGCGTGGCGGCGCGGAGG - Intergenic
1128231667 15:66039750-66039772 AGCCGGGTCAGGCGGCGGTGGGG + Intronic
1128231678 15:66039784-66039806 AGCCGGGTCAGGCGGCGGTGGGG + Intronic
1128231689 15:66039818-66039840 AGCCGGGTCAGGCGGCGGTGGGG + Intronic
1128231700 15:66039852-66039874 AGCCGGGTCAGGCGGCGGTGGGG + Intronic
1128231711 15:66039886-66039908 AGCCGGGTCAGGCGGCGGTGGGG + Intronic
1128231722 15:66039920-66039942 AGCCGGGTCAGGCGGCGGTGGGG + Intronic
1128231733 15:66039954-66039976 AGCCGGGTCAGGCGGCGGTGGGG + Intronic
1128231744 15:66039988-66040010 AGCCGGGTCAGGCGGCGGTGGGG + Intronic
1128392005 15:67188616-67188638 CGCAGGAGCTGGCGGCTGGCAGG - Intronic
1128750056 15:70142481-70142503 GGTGGGGGGTGGCGGCGGGGAGG - Intergenic
1129221755 15:74135319-74135341 CGGTGGGGCGGGCTGCGGGGTGG - Exonic
1129814641 15:78540750-78540772 CGCCGGGGCCCGCGAGGGGGCGG + Intronic
1130979481 15:88803155-88803177 CTCCGGGGCTGGCGGGAGGAAGG - Intergenic
1131049092 15:89334645-89334667 CGGCGGGGTCGGCGGCGGGGAGG - Intronic
1131054600 15:89368127-89368149 GGCCGGGGCGGTCGGTGGGGCGG - Intergenic
1131819911 15:96261941-96261963 GGGAGGGGCTGGGGGCGGGGTGG - Intergenic
1131832216 15:96361217-96361239 TCCCGGGGCCGGGGGCGGGGAGG - Intergenic
1132182634 15:99770662-99770684 TGGCGGGGCGGGGGGCGGGGGGG - Intergenic
1132314378 15:100879666-100879688 CGCAGGGGCGGCGGGCGGGGCGG + Exonic
1132464743 16:72364-72386 GGCCGGGGCCGGGGCCGGGGAGG - Intronic
1132475947 16:138278-138300 GGCCGGGGCCGGGGGCGGAGGGG + Exonic
1132512648 16:352202-352224 CAGCGGGACTGGCGGCGCGGTGG - Intronic
1132519712 16:381643-381665 GGCCGGGGCTGCGGGCGGGGCGG - Intronic
1132607640 16:800222-800244 CACCGGGGATGGGGGCGGGTAGG - Intronic
1132670600 16:1100800-1100822 CGCGGGGGGAGGGGGCGGGGAGG + Intergenic
1132683450 16:1153023-1153045 GGGCGGGGCCGGGGGCGGGGCGG - Intergenic
1132710009 16:1262358-1262380 CTCCGGGGGTGGTGGTGGGGTGG - Intergenic
1132779369 16:1614363-1614385 CGCCCGGGCCGGCGGCGGGAGGG - Intronic
1132779414 16:1614452-1614474 GGCCGGGGGCGGCGGCGTGGGGG + Intronic
1132805484 16:1773270-1773292 GGCCGGGGCCGGGGACGGGGCGG + Exonic
1132893244 16:2214813-2214835 CGCCGCGGCGGGCGGCTGCGAGG - Intergenic
1132934522 16:2473961-2473983 AGCCGCGGCTGGGGGCGCGGGGG + Exonic
1133013139 16:2925737-2925759 GGCCGGGGCTGGGGGAGGTGTGG + Intronic
1133049110 16:3106639-3106661 CGCAGGTGAGGGCGGCGGGGCGG + Intergenic
1133069442 16:3235659-3235681 CGCCGTGGGGGGTGGCGGGGTGG - Intronic
1133197862 16:4183875-4183897 CGTGGGCGCTGGGGGCGGGGCGG - Intergenic
1133259428 16:4538564-4538586 CGCCGCGGGCGGGGGCGGGGAGG + Intronic
1133784358 16:8963370-8963392 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1134005828 16:10818447-10818469 TGCTGGGGCTGGAGGCGGGGCGG - Intronic
1135752330 16:25067117-25067139 CCCCAGGGCTGGCGGGGAGGCGG - Intergenic
1135811992 16:25596052-25596074 CACCGGGGCTGGTTGGGGGGTGG + Intergenic
1136383269 16:29906973-29906995 TGGTGGGGCTGGCCGCGGGGAGG - Exonic
1136399809 16:30011096-30011118 CGCTGGGGCTGGGGAGGGGGCGG + Intronic
1136574962 16:31117904-31117926 GCCCAGGGCTGGGGGCGGGGCGG + Intronic
1136672909 16:31874053-31874075 CCCCGAGGCTGACTGCGGGGAGG - Intronic
1136683654 16:31981957-31981979 AGCCCGGGCTGGCGGCGGCGGGG + Intergenic
1136784281 16:32925517-32925539 AGCCCGGGCCGGCGGCGGCGGGG + Intergenic
1136885503 16:33928289-33928311 AGCCCGGGCCGGCGGCGGCGGGG - Intergenic
1137303787 16:47180742-47180764 CGCCAAGGCAGGCGGCTGGGAGG - Intronic
1137585962 16:49664249-49664271 CGCCGGCCCAGGCGGCCGGGTGG - Intronic
1137623792 16:49894727-49894749 TGCCAGGGCTGGGGGAGGGGAGG + Intergenic
1137665276 16:50246046-50246068 CGCGGGGGCGGGAGCCGGGGCGG - Intergenic
1138327987 16:56191411-56191433 CGCCTGGGCCCGGGGCGGGGAGG - Intronic
1138360690 16:56425195-56425217 CGCCGGGGCCGGCCTCGGGCTGG + Exonic
1138398890 16:56730016-56730038 GGGCGGGGCCGGGGGCGGGGCGG - Intronic
1138501376 16:57447194-57447216 AGCCGGGGCTTTCAGCGGGGCGG + Intronic
1139394660 16:66630697-66630719 GGCCAAGGCTGGCGGCTGGGAGG - Intronic
1139466157 16:67155201-67155223 GGCCCGGGGTGGCGACGGGGAGG - Exonic
1139551172 16:67673968-67673990 GGCGGGGGGTGGGGGCGGGGGGG - Intergenic
1139576789 16:67847081-67847103 CGCCGGGGGGGGGGGAGGGGAGG - Intronic
1139958038 16:70702510-70702532 CTCTGGGGCTGGCAGCGGAGGGG + Intronic
1140408203 16:74724952-74724974 CGCCAGGGCTGGCAGCCGGAGGG - Intronic
1141054526 16:80803713-80803735 CGCCGCGGCCGGCGGGGGTGTGG - Intronic
1141185175 16:81781870-81781892 CTCGGGGGCGGGCGGGGGGGGGG - Intronic
1141430501 16:83968433-83968455 CGGCGGGGGTGGGGGCGGCGGGG + Intergenic
1141694799 16:85614211-85614233 CGGGAGGGCTGGGGGCGGGGAGG - Intronic
1141828635 16:86497619-86497641 GGCCGGGGGCGGGGGCGGGGCGG - Intergenic
1142005981 16:87689817-87689839 GGCGGGCGCGGGCGGCGGGGTGG - Exonic
1142120355 16:88383704-88383726 CGCCCGGGCGGGCGGCCCGGAGG - Intergenic
1142129993 16:88428075-88428097 CCCCGGGGCTGGGGGCCTGGGGG - Exonic
1142142764 16:88479855-88479877 CTGCGGGGGTGGCAGCGGGGGGG - Intronic
1142177480 16:88651694-88651716 GGCAGGGGCTGGCGTGGGGGTGG + Intergenic
1142350180 16:89576107-89576129 GGCCGGGGCTGGCGCCGAGCTGG + Intronic
1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG + Intergenic
1203086938 16_KI270728v1_random:1189523-1189545 AGCCCGGGCCGGCGGCGGCGGGG + Intergenic
1203120216 16_KI270728v1_random:1529634-1529656 GGCCGGGGGTGGGGGGGGGGGGG + Intergenic
1142695063 17:1628940-1628962 CGGCGGGGCGGGCGGGGGGCTGG - Intergenic
1142704233 17:1684427-1684449 CGCGCGGGCCGGAGGCGGGGCGG - Intronic
1142811790 17:2399011-2399033 CGCCGCGGCGGGCGGGGGTGGGG - Intronic
1143321205 17:6070400-6070422 AGCCGGGGCGGGCAGCGGGCGGG - Intronic
1143371637 17:6444239-6444261 CCACGAGGCTGGCGGCGGGGCGG + Intergenic
1143419294 17:6776367-6776389 CCCCGAGGCCCGCGGCGGGGAGG + Intronic
1143562672 17:7705023-7705045 CGCCGGGGGCTGAGGCGGGGCGG + Intergenic
1143590782 17:7885057-7885079 CGGCGGGGGCGGCGGCGGCGGGG - Exonic
1143606169 17:7987580-7987602 CACCAGGGATGGGGGCGGGGTGG - Intergenic
1143708618 17:8718163-8718185 CGCCCACGGTGGCGGCGGGGAGG + Intergenic
1143750501 17:9023407-9023429 CGGCGGAGCCGGCGGCGGGTGGG + Intronic
1144565356 17:16354772-16354794 CGCTGGGGCGGGGGGGGGGGGGG - Intergenic
1144586806 17:16492123-16492145 CGCGGGGGCGGGCGGGCGGGCGG + Intronic
1144586845 17:16492247-16492269 CGCGGAGGCGGGGGGCGGGGCGG - Intergenic
1144756481 17:17682837-17682859 AGCCCGGGCTGGCGGGGGCGCGG + Intronic
1144769569 17:17752186-17752208 TGCCGGGACTGGGCGCGGGGCGG + Intronic
1144784363 17:17823666-17823688 GGGCGGGGCTGGGGGCGGGGCGG - Intronic
1144828804 17:18120827-18120849 CGCCGGGGAGAGCGGCGGCGCGG - Exonic
1145928000 17:28662218-28662240 CGGCGGCGGTGGCGGCGGAGGGG + Exonic
1146132635 17:30291964-30291986 CGGCGGCGGCGGCGGCGGGGAGG + Exonic
1146255884 17:31391531-31391553 CGGCGGGGGCGGCGGCGGCGGGG - Intergenic
1146274778 17:31509724-31509746 CCCCGGGGCTGGCTGAGGTGTGG + Intronic
1146695252 17:34903973-34903995 CTCCGGGGGTGGCGGCTGGCTGG - Intergenic
1146757744 17:35448455-35448477 CGGCGCGGGTGGAGGCGGGGCGG - Intronic
1147110457 17:38257408-38257430 CGCCGGGGCAGAGGGCGGAGCGG + Intergenic
1147134776 17:38428519-38428541 GGCCGGGGCTCCGGGCGGGGCGG - Exonic
1147144572 17:38477664-38477686 AGCCCGGGCCGGCGGCGGCGGGG + Exonic
1147184232 17:38705130-38705152 CCCGGCGGCTGGCGGCGGGCGGG + Intergenic
1147212844 17:38882081-38882103 CGCCGGTGCTGGGGCGGGGGAGG + Intronic
1147250783 17:39151525-39151547 CCCCGGGGCTGGCGGAGGGGCGG + Exonic
1147250843 17:39151683-39151705 AGCTGGGGCAGGGGGCGGGGCGG + Intronic
1147360655 17:39927574-39927596 GGCCGGAGCTGCCAGCGGGGAGG - Intronic
1147382226 17:40062791-40062813 GGCGGGGGCGGGCGGCGGCGAGG + Exonic
1147661874 17:42121158-42121180 GGCAGGGGCTGGTGCCGGGGTGG + Exonic
1147897449 17:43759875-43759897 GGCCGGGGCGGGGGGCGGGGGGG + Intergenic
1147966943 17:44199088-44199110 CGCCGGGGCCGGCGCCGGGCCGG + Intronic
1147966964 17:44199159-44199181 GGCCGGGGCTGCTGGCGGGCGGG - Intronic
1147971162 17:44219705-44219727 GGCCGGGGCCGGCGGCGGGCGGG - Intronic
1147971521 17:44220923-44220945 CGCCGAGGCGGGCGGGCGGGCGG - Intronic
1148053805 17:44781765-44781787 CACCTGGGCTGGGGGTGGGGAGG + Exonic
1148111592 17:45147541-45147563 AGCCGGGGCCGGGGGCGGGCGGG - Intergenic
1148139192 17:45316634-45316656 GGGCGGGCCTGGCGGCGGCGCGG + Intronic
1148161351 17:45451887-45451909 CGCTGGGGCAGGCGGGGGAGAGG + Intronic
1148178200 17:45585293-45585315 CGCCGGGGCTGGGCGCAGCGAGG + Intergenic
1148445289 17:47733681-47733703 CGCCTGGGGTCGCGGCGGGTAGG - Exonic
1148495011 17:48048384-48048406 GGCCGGCGGTGGCGGCGGCGAGG + Exonic
1148684774 17:49495301-49495323 CGCCGGAGCTGGCCGCGGCTCGG - Exonic
1148782594 17:50130077-50130099 GGCGGGGGAGGGCGGCGGGGAGG + Intergenic
1148838429 17:50478899-50478921 AGCCCGGGCTCGCGGCTGGGCGG + Exonic
1148899661 17:50866391-50866413 CGGAGGGGATGGGGGCGGGGAGG - Intronic
1148930104 17:51120801-51120823 GGCCGGGGCCGGAGGAGGGGAGG + Exonic
1149599694 17:57885492-57885514 CGCCGGGGCACGCGGGGGCGGGG - Exonic
1149626354 17:58083349-58083371 CGGCGGCGCGCGCGGCGGGGGGG + Intergenic
1149805938 17:59618492-59618514 CGGCGGGGCGGGGGGTGGGGGGG + Intergenic
1150004007 17:61458321-61458343 CGCTGGGGCTGGTGGGGTGGGGG + Intronic
1150060583 17:62065369-62065391 CGGCGGCGGCGGCGGCGGGGGGG - Intergenic
1150228651 17:63538050-63538072 CATCAGGGCTGGGGGCGGGGCGG - Exonic
1150408099 17:64919583-64919605 CGCCGGGGCTGGGCGCAGCGCGG + Intergenic
1150638587 17:66933879-66933901 CTCCACGGCTGGCGGGGGGGGGG + Intergenic
1150782733 17:68135736-68135758 CGCCGGGGCGGGCGCCGAGCTGG - Intergenic
1151453556 17:74213497-74213519 AGGCGGGGCCGGGGGCGGGGCGG + Exonic
1151642334 17:75405376-75405398 CCCCGGGGTTCGCGTCGGGGCGG - Exonic
1151715224 17:75827742-75827764 AGCCAGGGCTGGAGGCAGGGAGG + Exonic
1151783771 17:76265370-76265392 CGGCGGAGCGGGCGGCGGAGCGG + Exonic
1151933508 17:77247626-77247648 CGCCGGGGGTCGGGGTGGGGAGG + Intergenic
1152008374 17:77696229-77696251 CGCCTGGGTTGGCGGAGCGGTGG + Intergenic
1152077555 17:78168757-78168779 CGCCGGGCCTGGCGACGGAGAGG - Intronic
1152197332 17:78925300-78925322 CGCCGGGCGGGGCGGCGGGGTGG + Exonic
1152321653 17:79611339-79611361 GGCCGGGGAGGGCGGCGGAGCGG + Intergenic
1152345536 17:79748484-79748506 CGCCTGGGCCGCCGGCGGTGCGG + Intergenic
1152349758 17:79778067-79778089 CGCGGGGGCGGGCGGCGGGCCGG + Intergenic
1152552003 17:81034787-81034809 CAGCCGGGCTGGGGGCGGGGAGG - Intergenic
1152581295 17:81166491-81166513 CACGGAGGCTGGCGGGGGGGGGG + Intergenic
1152626702 17:81390918-81390940 GGCTGGGGCTGGCGGCAGGAGGG - Intergenic
1152708864 17:81860299-81860321 CGCCGGGCCTGGCGGGCGGGCGG - Intronic
1152753669 17:82078112-82078134 CGCTGGGACTGGCGGGGGGGGGG - Intergenic
1152771631 17:82173122-82173144 TGCTGGGGCTGTGGGCGGGGAGG + Intronic
1152834403 17:82519939-82519961 CGGCGGGGCCGGGGGCGGCGGGG + Exonic
1152840671 17:82566055-82566077 GCCAGGGGCTGGGGGCGGGGAGG + Intronic
1152866492 17:82726744-82726766 TGCCTGGGCTGGGGGCGGTGGGG + Intronic
1152923909 17:83079186-83079208 CGCCGGGGCTGCCCGCAGGATGG + Intergenic
1154274506 18:12947816-12947838 TGACGGGCCTGGGGGCGGGGCGG + Intronic
1156325533 18:36071506-36071528 CCAAGGGGCTGGGGGCGGGGGGG + Intergenic
1156427002 18:37024533-37024555 CACCGGGGCTGGTTGTGGGGTGG - Intronic
1156448662 18:37254245-37254267 TGCCGGGGCCGGCGGGGGTGGGG - Intronic
1157279100 18:46334186-46334208 CGCGGGCGCGGGCGGCGGCGGGG - Intronic
1157464189 18:47930513-47930535 GCCCGGGCCTGGGGGCGGGGCGG - Exonic
1157610315 18:48951530-48951552 CGGCGGGGCTGACAGCGCGGGGG + Intergenic
1158259025 18:55587855-55587877 CGGGGGGGCTGGCGGCGAGGGGG + Intronic
1158259107 18:55588152-55588174 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1158435898 18:57435536-57435558 CGCCCGGGGTGGGGGCGGGGTGG - Intergenic
1158468367 18:57712276-57712298 TGCTGGGGCTGGGGGAGGGGTGG - Intronic
1158647831 18:59263739-59263761 CGCCAGGGCTGGGGGAGGTGTGG + Intergenic
1158649416 18:59272937-59272959 CGCCGGGGCTGGCGGCGGGGAGG + Exonic
1159298224 18:66523898-66523920 CTCCGGGGGTGGGGGCGGGGGGG + Intronic
1159511291 18:69400923-69400945 TGCCGGGGGCGGCGGCGCGGTGG + Intergenic
1159770392 18:72541764-72541786 TCCCCGGGCTGGGGGCGGGGTGG + Intronic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1159945537 18:74441918-74441940 CGCCAGGGCTGGGGGAGGAGAGG - Intronic
1160163212 18:76491271-76491293 GGCCGGGGCCGGGGCCGGGGAGG - Intronic
1160255973 18:77249607-77249629 CGCCGGGGTGGGAGGCGGAGGGG - Intergenic
1160453617 18:78980717-78980739 CGCTGAGGCCGGCGGCGGCGGGG + Intronic
1160454847 18:78992959-78992981 CTGCGGCGCTGGCGCCGGGGCGG - Exonic
1160539451 18:79612512-79612534 CGCAGGAGCTGGCCGCTGGGTGG + Intergenic
1160592419 18:79951779-79951801 AGCCGGGGCTGTCGGGGCGGTGG + Intergenic
1160688226 19:447291-447313 CGCCGGGGATGGGGAGGGGGTGG + Intronic
1160747633 19:719461-719483 CGCCGGGGTGGGCGTCGGGCGGG + Intronic
1160747807 19:720069-720091 CGCTGCGGCTGGGGGAGGGGAGG - Intronic
1160766823 19:812545-812567 CGGCGGGGCCGGGGGCGGGCGGG - Exonic
1160775433 19:853107-853129 GGCCGGGGCTGCTGGCGGGGGGG + Intronic
1160831929 19:1108291-1108313 CGCGGGGGCGGGGGGCGCGGCGG - Exonic
1160889248 19:1368656-1368678 CACCTGGGCTGGCAGCAGGGTGG - Intronic
1160947677 19:1651279-1651301 CTCCGAGGCTGGGGGTGGGGAGG + Intronic
1160952853 19:1675876-1675898 CGCCCGGGCCGGCGGGGAGGGGG - Intergenic
1160992104 19:1864118-1864140 CGCCGGGGCGCGCGGCCGGCGGG + Intergenic
1161041593 19:2113363-2113385 GGCGGGGGCAGGCGGTGGGGTGG + Exonic
1161087112 19:2340373-2340395 CGCCAGGGGTGGCGGGGGGAGGG + Intronic
1161200020 19:3009480-3009502 CCCAGGGGCTGGGGGCCGGGAGG - Intronic
1161210362 19:3062427-3062449 CGGGGAGGCGGGCGGCGGGGAGG - Intronic
1161216191 19:3096012-3096034 CTCCTGGGCCGGGGGCGGGGCGG + Intronic
1161267109 19:3369500-3369522 AGCCGAGGCTGGCGGGGGGTGGG + Intronic
1161289119 19:3483380-3483402 TGCCGGGGCTGGCGGCCGAGGGG - Intergenic
1161401363 19:4067278-4067300 CGCAGGGGCGGGGTGCGGGGGGG + Intergenic
1161403279 19:4078261-4078283 GGCCGGGGCGGGGGGGGGGGGGG + Intergenic
1161476902 19:4491267-4491289 CGCCGGGGGGGGTGGGGGGGTGG - Intronic
1161505081 19:4639509-4639531 AGCCGGGGCCGGGGCCGGGGCGG - Intronic
1161589995 19:5125250-5125272 CGCCGGGGCTGGGGAGGGTGTGG - Intronic
1161779170 19:6279795-6279817 CGCGGGGCCCGGGGGCGGGGCGG - Exonic
1161959533 19:7516155-7516177 CGGCGGGGCTGGCGGGCGGGGGG + Exonic
1161959583 19:7516275-7516297 GGCCGGGGCGGGGGGCTGGGTGG + Intronic
1162035090 19:7934271-7934293 CACCGGCCCTGGCGGCCGGGGGG + Intronic
1162396471 19:10420487-10420509 AGCCGGGGCTGGCGCCGAGCGGG + Intronic
1162410582 19:10502930-10502952 CGCCCAGCATGGCGGCGGGGCGG + Intronic
1162451413 19:10757368-10757390 CCCAGTGGCTGGCGTCGGGGGGG - Intronic
1162538288 19:11277125-11277147 GGCCAGGGCAGGCGGCTGGGAGG + Intergenic
1162562064 19:11422664-11422686 CTCTGGGGAGGGCGGCGGGGCGG - Intronic
1162675769 19:12296863-12296885 GGCAGGGGCGGGGGGCGGGGCGG + Intergenic
1162798329 19:13097992-13098014 CGACAGGGCTGGTTGCGGGGTGG - Intronic
1162808690 19:13151802-13151824 CGGCGGGGCTTCCGGGGGGGGGG - Intronic
1162861067 19:13506155-13506177 CTCCGGGGCAGCCGCCGGGGTGG - Exonic
1162861109 19:13506313-13506335 TGCCGGGGCTGGGAGCGCGGCGG + Intronic
1162954338 19:14090082-14090104 CGCCGGCGGGGCCGGCGGGGTGG + Exonic
1162954499 19:14090776-14090798 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1163089715 19:15011227-15011249 GGCCGAGGCGGGCGGCGGTGAGG - Exonic
1163530870 19:17848081-17848103 TGCGGGAGCTGGGGGCGGGGAGG + Intergenic
1163566153 19:18052324-18052346 GGTGGGGGCTGGGGGCGGGGAGG + Intergenic
1163655667 19:18543524-18543546 GGCCGCGGCTGGGGGCGGGGAGG - Exonic
1163666701 19:18606898-18606920 CGGGCGGGCGGGCGGCGGGGAGG - Intronic
1163701875 19:18790213-18790235 CCCCGGGGCGGGGGGTGGGGGGG - Intronic
1163726783 19:18927728-18927750 AGCCGGGGGTGGGGGTGGGGAGG - Intronic
1163748250 19:19060601-19060623 CGACGGGGATGGGGGCTGGGGGG - Intergenic
1163786438 19:19277239-19277261 CCCCGGGGCGGGCGGGGGGGGGG + Intronic
1163807082 19:19405930-19405952 CGCGGGGCCGGGCGGCGGAGGGG - Intronic
1164051158 19:21586639-21586661 CGCCGGGGCGGGCGGCCGAGCGG + Intergenic
1164644051 19:29845068-29845090 CCGCGGGGCCTGCGGCGGGGTGG + Intergenic
1165157536 19:33797118-33797140 GGCGGGGGCTGGCGGCGCGGGGG + Intronic
1165350104 19:35270488-35270510 GGCCGAGGCTGTCAGCGGGGAGG + Exonic
1165894026 19:39130883-39130905 CGCGGGGGGTGGCGACAGGGAGG + Intronic
1166045281 19:40226347-40226369 CACCAGGGCAGGCGGCGGGTAGG + Intronic
1166097399 19:40549424-40549446 CGCAGGGGCCTGGGGCGGGGCGG + Intronic
1166142448 19:40812239-40812261 CACTAGGGCTGGGGGCGGGGTGG - Intronic
1166304100 19:41928008-41928030 CGCCGCGGCCGGCGCAGGGGCGG - Intronic
1166304142 19:41928133-41928155 CACCGGGGCGAGGGGCGGGGTGG + Intronic
1166307086 19:41941029-41941051 CCCCGGGGCTGGCTGCAGCGGGG - Intergenic
1166677483 19:44748631-44748653 CGGGGGGGCCGGGGGCGGGGAGG + Exonic
1166746035 19:45142288-45142310 GGCCGTGGCTGGGGACGGGGAGG - Exonic
1166882945 19:45940219-45940241 GGCCGGGGCGGGCGGCGGGGCGG - Exonic
1166882983 19:45940295-45940317 AGGCGGGGGCGGCGGCGGGGCGG + Exonic
1167001035 19:46746032-46746054 CGCCGGGACGGCCGGCGGGGGGG - Exonic
1167018287 19:46856220-46856242 CGCGGGGGCTGGCAGAGCGGTGG - Intergenic
1167019049 19:46860983-46861005 CCTCGGGGCGGGGGGCGGGGAGG - Intergenic
1167072915 19:47230945-47230967 CGCCGGAGGGGGCGGCGGTGGGG + Intronic
1167111694 19:47466305-47466327 GGCCGGGGGAGGCGGCAGGGAGG + Exonic
1167268290 19:48493993-48494015 CGCCGGGGCGGCTGGCGGGGAGG - Exonic
1167357169 19:49011111-49011133 GGCCGGGGCGGGTGGTGGGGTGG + Intronic
1167433116 19:49464535-49464557 CGGGGGGGCTGGTGACGGGGAGG - Intronic
1167564383 19:50247125-50247147 AGGCGGGGCTGGCGGTGGGCAGG + Intronic
1167643683 19:50695042-50695064 GGCCGGGGCTGGGGCCGCGGCGG - Intronic
1167689215 19:50975139-50975161 AGGAGGGGCTGGCGGGGGGGGGG + Intergenic
1168072118 19:53959144-53959166 CGCAGGGGCTGGGGGGGAGGGGG - Intergenic
1168076353 19:53982609-53982631 CGGCGGAGGCGGCGGCGGGGCGG + Exonic
1168100332 19:54138061-54138083 CGCCAGGGCGGGAGGCGGCGGGG - Intronic
1168247042 19:55117602-55117624 CCCCGGGGCGGGCGGGCGGGCGG - Intergenic
1168282604 19:55313427-55313449 GTCCGAGGCTGGCGGCAGGGAGG - Intronic
1168309350 19:55452701-55452723 AGCCGGGGGTGGCGGCGTGGGGG + Intergenic
1168315342 19:55482506-55482528 GGACGGGGGTGGCGGCGGGACGG - Exonic
1168332606 19:55578992-55579014 AGCTGGCGCTGGCGGCCGGGCGG - Exonic
1168335221 19:55593424-55593446 CTCAGGGGCCGGCGGCGGAGAGG - Exonic
1168343798 19:55641035-55641057 CGCGGGGACTGGGGGCGCGGGGG - Intronic
925345542 2:3169585-3169607 GGCCAGGGCTGGCGGCAGGAGGG + Intergenic
925380682 2:3423505-3423527 TGCCGGGGCTGGGGGTGGGGAGG - Intronic
925407136 2:3613153-3613175 CGGCTGGGCTGCAGGCGGGGAGG + Intronic
925535991 2:4917224-4917246 TACCGAGGTTGGCGGCGGGGAGG - Intergenic
925590850 2:5507825-5507847 GCCCGGGGCTGGGGGTGGGGGGG + Intergenic
925730629 2:6917656-6917678 CGCCCGGGCCGGCCGCGGAGCGG + Intronic
925984761 2:9206784-9206806 CGTCGGGGCCCGCGGCTGGGTGG + Exonic
926083816 2:10008959-10008981 TGCCTGGGATGGGGGCGGGGCGG + Intergenic
926282985 2:11465690-11465712 CAGCGGGGTTGGCGGCGGCGCGG + Intronic
927667394 2:25042151-25042173 CGCGGGGGCCGGCCGCGGGCAGG - Exonic
927698361 2:25252294-25252316 CGATGGGGCTGGGGGCGGAGGGG + Intronic
927702016 2:25275062-25275084 TCCCGGGGCCGGCTGCGGGGTGG - Exonic
927932081 2:27051829-27051851 GGCCGGGGCTGGCGGGGCCGGGG - Intronic
928025488 2:27735756-27735778 CGCCGGGGCTGCCGGAAGCGGGG - Intergenic
928186562 2:29115712-29115734 CGGCGGGGTTGGGGCCGGGGTGG + Intronic
928412603 2:31066404-31066426 TGCGGGGGCGGGGGGCGGGGGGG + Intronic
928471566 2:31581036-31581058 CGCCAGGGCTGGACGCGGCGAGG - Exonic
928964831 2:36966352-36966374 TGCCGCGGCCGGCGACGGGGCGG - Exonic
929460871 2:42101422-42101444 CGCTGCGGTTGGCGGCGGGCAGG - Intergenic
929604414 2:43225587-43225609 TGCCGGGGCTGGGCGCGGGGTGG + Exonic
929949292 2:46393933-46393955 CTCCGGGGGTGGCGGGGGGGGGG + Intergenic
930124351 2:47783895-47783917 GGGCGGGGCGGGGGGCGGGGTGG + Intronic
930136046 2:47905412-47905434 GGCCGGGGCGGGCGGGCGGGCGG - Intronic
930136355 2:47906534-47906556 CGCGGGGGAGGGCCGCGGGGCGG + Intergenic
931576299 2:63722088-63722110 GGCCAAGGCAGGCGGCGGGGAGG - Intronic
931604850 2:64042098-64042120 GGCCAAGGCAGGCGGCGGGGAGG + Intergenic
931881695 2:66576325-66576347 CGCGGGGGGTGGCGGGGGTGGGG + Intergenic
932036461 2:68251950-68251972 AGCCGGAGAGGGCGGCGGGGCGG - Intronic
932380374 2:71276670-71276692 AGCCTGGGCTGCCGCCGGGGTGG - Intronic
932735635 2:74252258-74252280 CGGCGGGGCTGGCAGTGGCGGGG - Exonic
933666855 2:84971274-84971296 CGGCGGCGGCGGCGGCGGGGAGG - Exonic
933684731 2:85133750-85133772 CGCCGGGGCGGCCGGCGGAGGGG + Exonic
933753226 2:85616550-85616572 CGCCGGAGTTGGGGGAGGGGTGG + Intronic
933847464 2:86337419-86337441 GCCCGGGGCCGGGGGCGGGGAGG + Intronic
934079118 2:88452460-88452482 CGGCGGCGGTGGCGGCGGGCGGG + Exonic
934612905 2:95753950-95753972 AGCCTGGGCTGGGGGCAGGGAGG - Intergenic
935046639 2:99489526-99489548 CCATGGGGCTGGCGGCGGCGCGG + Intronic
935046720 2:99489786-99489808 CCCCCGGGCCGGCGGCGGGGTGG - Intronic
935196486 2:100819793-100819815 CGCCGGGGCTGGGGGAGGGGGGG - Intergenic
935255784 2:101308540-101308562 CGTCGGGGCTCGCGGCGTGTTGG - Exonic
935592516 2:104855470-104855492 CGGCGGTGGTGGCGGCGGTGGGG + Intergenic
935592548 2:104855588-104855610 GGCAGGGGCTGGCGGCGGCGGGG + Exonic
936038371 2:109129915-109129937 CGCCGGGGCTGGTGCCCGCGCGG - Exonic
936126706 2:109794593-109794615 CGGCGGCGGCGGCGGCGGGGGGG + Intronic
936520637 2:113210125-113210147 CCCTGGGGCTGGCTGCTGGGAGG + Intergenic
937221813 2:120346298-120346320 TGGCGGGGGTGGCGGCGGCGCGG - Exonic
938072807 2:128317448-128317470 ACCTGGGGCTGGGGGCGGGGAGG - Intronic
938296468 2:130182326-130182348 CCCCGGGGCTGGAGGCGGCCCGG + Exonic
938449425 2:131403887-131403909 CGGTGGGGGAGGCGGCGGGGTGG - Intergenic
938460283 2:131492311-131492333 CCCCGGGGCTGGAGGCGGCCCGG - Exonic
938795848 2:134718234-134718256 CGCCGGGGCGGGCAGCCGGGCGG + Intronic
938959630 2:136329557-136329579 GGTCGGGGCTGGGGGTGGGGGGG + Intergenic
939969657 2:148644959-148644981 CGGCGGGGCGGGCGGGGAGGGGG - Intronic
940650482 2:156436152-156436174 GGCCGGGGTTGGCGGGGGTGTGG - Intronic
940830028 2:158456907-158456929 CGGGAGGGCTGGCAGCGGGGCGG + Intergenic
941819173 2:169827702-169827724 GGCCGCGGCTGCCGGCGGCGAGG + Exonic
941929974 2:170929442-170929464 AGGCGGGGCCGGCCGCGGGGAGG + Intronic
942314247 2:174683068-174683090 CGCAGAGGATCGCGGCGGGGCGG + Intergenic
942346209 2:175005232-175005254 CGCAGTGGCTGGCGGAGAGGCGG + Intronic
942450922 2:176107634-176107656 CGGCGGGGGCGGCGGCGGCGCGG + Exonic
942451026 2:176107997-176108019 GACCGGGGCTGGTGGCGGCGGGG + Exonic
942970830 2:181956042-181956064 GGGCAGGGGTGGCGGCGGGGAGG - Intronic
943060600 2:183038342-183038364 CGCCGGGGGTGGGGGCGGAAGGG - Exonic
943185184 2:184598369-184598391 CGCGGGTCCCGGCGGCGGGGTGG + Exonic
943369596 2:187001495-187001517 CTCGGGGGCTGGGGGCAGGGAGG + Intergenic
945323396 2:208454036-208454058 CTCCGGGGCTGACTGCAGGGAGG + Intronic
946196166 2:218034026-218034048 CGCAAGGGCTGGGGGCGGGCCGG - Intergenic
946362786 2:219229235-219229257 CGCCGCGGCTGGGTGTGGGGAGG - Exonic
946386619 2:219387819-219387841 GGGCGGGGCAGGCGGCGCGGTGG - Exonic
946692570 2:222320123-222320145 CGCCTGGGCTCCGGGCGGGGAGG + Intergenic
946748240 2:222866764-222866786 CCCCGGGGCGGGGGGGGGGGGGG - Intronic
948208863 2:236178085-236178107 CGCTGGAGATGGCGGGGGGGAGG + Intergenic
948265730 2:236633999-236634021 GGTCGGGGCTGGCGGGGCGGCGG + Intergenic
948425628 2:237885322-237885344 GGCAGGGGCAGGCGGCGGGCAGG - Intronic
948473837 2:238203761-238203783 CGGGGCGGCTGGGGGCGGGGCGG + Intergenic
948479107 2:238239468-238239490 CGCGGTGAGTGGCGGCGGGGCGG - Exonic
948479602 2:238241157-238241179 CGCCGGGGCAGGAGCCGGGCAGG - Intergenic
948492146 2:238320573-238320595 CGGCGGGGCCGGCGGCGGCCAGG + Exonic
948751708 2:240136819-240136841 AGCCGGGGCGGGAGACGGGGGGG + Intergenic
948991676 2:241558863-241558885 GGACGGGGCGGGCGCCGGGGCGG + Exonic
1168795890 20:610059-610081 CCCGGGGGCGGGCGGCGGGCGGG - Exonic
1170150380 20:13221376-13221398 CTGCGGGGTCGGCGGCGGGGCGG - Intergenic
1170204699 20:13785313-13785335 CGGCGGGGCGGGCGACGCGGAGG + Intronic
1170592908 20:17784673-17784695 CGGTGGGGTTGGCGGCGGGTAGG + Intergenic
1170717190 20:18842130-18842152 CCCCTGGGCTGGGGGCCGGGTGG + Intergenic
1170889036 20:20364056-20364078 GGCCCGGGCGGGCGGCGGGAAGG - Intergenic
1171011498 20:21511855-21511877 CGGCGGCGGTGGCGGCGAGGAGG - Exonic
1171123214 20:22582923-22582945 GGCCGGGGCGGCCGGCGTGGCGG - Exonic
1171123636 20:22584607-22584629 CGCGGGGGCTAGTGGGGGGGTGG + Intronic
1171370838 20:24661175-24661197 TGCTGGGGGTGGGGGCGGGGAGG + Intronic
1171481909 20:25460754-25460776 CGCCAGGGCCAGCGCCGGGGGGG + Intronic
1171724422 20:28602992-28603014 CGCCGGTACTGGCGGTGGCGGGG + Intergenic
1172529305 20:35619109-35619131 CGCGGGGGCTGGGGGCGGGTGGG - Intronic
1172599662 20:36175091-36175113 ACCCGGGGCGGGCGGCGGTGGGG + Intronic
1173256263 20:41396014-41396036 GGCAGGGGTTGGGGGCGGGGCGG - Intergenic
1173548153 20:43914830-43914852 TGCCTGGGCGGGCGGCGGGTGGG - Intergenic
1173791942 20:45833772-45833794 GGGCGGGGCAGGAGGCGGGGCGG + Intergenic
1173865078 20:46308142-46308164 CGGCCGGGCAGGCGGCGCGGGGG - Intronic
1174188295 20:48722439-48722461 GGCAGGGGCTGGAGGAGGGGAGG + Intronic
1174246930 20:49188400-49188422 GGCCGGGCCTGGAGGCGGGCGGG - Intergenic
1174380711 20:50153734-50153756 CGCCGGGCGCGGCGGCGGCGCGG + Exonic
1175215513 20:57390105-57390127 TGCCCTGGCTGCCGGCGGGGAGG - Intergenic
1175470220 20:59222280-59222302 TGCCCGGGCGGGCGGCGGGGTGG + Intronic
1175521435 20:59604825-59604847 CGCCGGGGCTGGCTTCAGGGCGG - Exonic
1175714642 20:61247325-61247347 CGCCGGGGAGGCGGGCGGGGTGG + Intergenic
1175846954 20:62064626-62064648 CCCGGGGGCGGGCGGCGGGACGG + Exonic
1175847097 20:62064983-62065005 CGCGGGGGGTGGCGGGGGCGGGG + Exonic
1175877804 20:62238665-62238687 GGCTGGGGCTGGAGCCGGGGCGG + Intronic
1175900969 20:62359811-62359833 GGCAGGGGCTGGCGCAGGGGAGG - Intronic
1175903293 20:62368264-62368286 CCGAGGGGGTGGCGGCGGGGTGG + Intergenic
1175997156 20:62817018-62817040 CGTCGGGGCGGGCGGCGCGCGGG - Intronic
1176005578 20:62860954-62860976 GGCCGGGGCCGGGGCCGGGGCGG - Intronic
1176005838 20:62861866-62861888 GGGCGGGGCTGGCGCAGGGGTGG - Intergenic
1176029532 20:63005282-63005304 GGCAGCGGATGGCGGCGGGGGGG + Intergenic
1176062640 20:63178995-63179017 CCGCGGTGCTGGCGGCGGGGCGG + Intergenic
1176131759 20:63499295-63499317 CGCCGCGGGCGGGGGCGGGGCGG + Exonic
1176141419 20:63546713-63546735 GGCAGGGGCTGGGGGCTGGGAGG - Intronic
1176194684 20:63831572-63831594 CCCCTGGGCTGGCGGGGGGCTGG + Intergenic
1176197126 20:63842506-63842528 CACAGGGGCTGGGGTCGGGGAGG + Intergenic
1176254258 20:64142616-64142638 CACAGGGGCTGGAAGCGGGGTGG + Intergenic
1176548975 21:8213452-8213474 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1176556868 21:8257664-8257686 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1176567904 21:8396482-8396504 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1176575808 21:8440701-8440723 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1177570785 21:22883596-22883618 CACCGGGGCTTGTTGCGGGGTGG - Intergenic
1178334528 21:31731772-31731794 AGCCGGGCCTGGTGGCCGGGGGG + Exonic
1178561504 21:33642909-33642931 CCTCGGGGGTGGCGGCGGAGTGG + Intronic
1178948424 21:36966730-36966752 CCCCGGGCCAGGCGGCGCGGGGG + Intronic
1179151423 21:38812007-38812029 CGCCTGGCCTGGGGGCGGGGAGG + Intronic
1179411777 21:41168130-41168152 CACCGGGACCGGCGGCGGCGGGG - Exonic
1179511857 21:41878909-41878931 CGCTGGGCCTGGCCGCGGGCGGG + Intronic
1179605693 21:42513967-42513989 CGCAGGTGCGGGCGGGGGGGCGG - Exonic
1179626893 21:42653931-42653953 CGCCGGGGCCGGGCGCGGCGGGG + Intronic
1179674941 21:42974821-42974843 GCCCGGGGCAGGGGGCGGGGAGG + Intronic
1179920685 21:44505573-44505595 TGCCGGGGCTGGGGGGGGGGGGG - Intronic
1180085354 21:45505659-45505681 CGCAGGAGCTGGCGGCAGGCAGG + Intronic
1180090400 21:45531144-45531166 CCACGGGGCAGGGGGCGGGGAGG + Intronic
1180090422 21:45531188-45531210 CCACGGGGCAGGGGGCGGGGAGG + Intronic
1180110082 21:45643470-45643492 GGGTGGGGCTGGGGGCGGGGCGG - Intergenic
1180193513 21:46180766-46180788 GGCCCGGGCTGGCAGCGGGGAGG - Intronic
1180297968 22:10961666-10961688 CGCCGGTGCTGGCGGTGGCGGGG + Intergenic
1180455376 22:15510206-15510228 CGCCGGCGCTGGCAGGGGGAGGG - Intergenic
1180650215 22:17370304-17370326 CGGCGGGGCCGGGCGCGGGGGGG + Intronic
1180699627 22:17774305-17774327 CGCCGGGGCAGGCGGCAGGCAGG + Intronic
1180843797 22:18970903-18970925 GGCCGGGGGTGGCGGCCCGGGGG + Intergenic
1180876921 22:19178881-19178903 CGCCGAGGCAGGCGTAGGGGCGG + Intergenic
1181026612 22:20131127-20131149 CGACGGCGCTGTGGGCGGGGTGG - Intronic
1181026823 22:20131726-20131748 CGCTGGGGGCCGCGGCGGGGCGG - Intronic
1181085168 22:20436492-20436514 AGGCGGGGCTCGCAGCGGGGAGG + Intronic
1181270951 22:21658104-21658126 GGCCGGGGATGGGGGTGGGGTGG + Intronic
1181280591 22:21717128-21717150 GGCCGGGGCTGGGGGGGCGGGGG + Intronic
1181457904 22:23070199-23070221 GGCCGGCGCTCGTGGCGGGGCGG + Intronic
1181467206 22:23116700-23116722 CGCCTGGGCTGGGGGTGGGGAGG - Intronic
1181670604 22:24424026-24424048 GTCCGGGGCTGGTGGCCGGGCGG + Intronic
1182124050 22:27803890-27803912 CCCCGGGGCGGGCGGGGGGGGGG - Intergenic
1182296929 22:29315410-29315432 GGCAGGAGCTGGCGGCGGGAGGG + Exonic
1182355240 22:29719903-29719925 CTCAGGGGCCGGCGGCGGGAAGG + Intergenic
1182481837 22:30614288-30614310 TGGCGGGGCTGGCTGCTGGGTGG + Intronic
1183067265 22:35371888-35371910 CGCCTGGGCGGGGGGGGGGGGGG - Intergenic
1183214148 22:36468231-36468253 GGCCAGGGCTGGGGGCAGGGAGG + Intronic
1183323618 22:37179783-37179805 CCCCGGGGCGGGAGGTGGGGGGG + Intergenic
1183368589 22:37419907-37419929 GGCGGGGGCTGGCGGCGGGGCGG - Intronic
1183517135 22:38273043-38273065 CGCCGGGGAGGGCGGGGCGGCGG + Intergenic
1183546057 22:38455351-38455373 AGCGGGGGACGGCGGCGGGGAGG - Intergenic
1183642441 22:39100827-39100849 AGCCGGGGCGGGGGGCGGGGAGG - Intronic
1184062202 22:42090428-42090450 GGCCGGACCTGGCGGCGGCGCGG - Intronic
1184086831 22:42270463-42270485 CGCCCGGGCCGGCGGCGGGGCGG + Intronic
1184229584 22:43151504-43151526 GGCGGGGCCTGGCGGCTGGGAGG + Intronic
1184236526 22:43186191-43186213 TTCCCGGGCTGGCGGGGGGGGGG - Intronic
1184276480 22:43411948-43411970 CGCGCGGGCGGGCGGCGGAGGGG + Intronic
1184547713 22:45183070-45183092 GGCAGGGGTTGGGGGCGGGGGGG + Intronic
1184671366 22:46013757-46013779 CGCCTGGGAAGGCGGCCGGGGGG - Intergenic
1184680738 22:46071190-46071212 GCCCGGGGCGGGCGGCGGGAGGG + Intronic
1184779274 22:46638205-46638227 CACAGGGGCTGGGGGCGTGGGGG + Intronic
1185179532 22:49351122-49351144 TGCCAGGGCTGGCGGAGGGTGGG + Intergenic
1185315667 22:50178208-50178230 GTCAGGGGCGGGCGGCGGGGCGG - Exonic
1185333358 22:50261349-50261371 GGGCGGGGCGGCCGGCGGGGCGG - Intronic
1185374143 22:50474557-50474579 GGCCGGGGCCGGGGGCCGGGCGG - Intronic
1203253859 22_KI270733v1_random:129759-129781 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1203261915 22_KI270733v1_random:174838-174860 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
950377019 3:12580449-12580471 CACTGGGGGTGGTGGCGGGGGGG - Intronic
950400958 3:12768909-12768931 GGCCGGGGCCGGGGCCGGGGCGG + Intronic
952302984 3:32120928-32120950 AGCTGGGGCTGGAGGCGGGGAGG + Intronic
952955047 3:38551622-38551644 TGCAGGGGTTGGCGGTGGGGGGG + Intronic
953406998 3:42664553-42664575 CGCCGGGGCTGGCAGTGGTGGGG - Exonic
953464356 3:43105910-43105932 CGCTGGGGGCGGCGGCGGGGTGG - Exonic
953485066 3:43286889-43286911 GGCGCGGCCTGGCGGCGGGGCGG + Intronic
953705155 3:45225535-45225557 CGCTGGGGGCGGCGGCGGGCCGG + Exonic
953839069 3:46374024-46374046 AGCCTGGGCTGGGGGTGGGGTGG + Exonic
953947907 3:47164528-47164550 CTCCGGGGCTCCCGGCGGGCAGG - Intergenic
954004217 3:47578863-47578885 CGGCGGCGCGGGAGGCGGGGAGG - Exonic
954141635 3:48609781-48609803 CGCAGGGACTGGCGGCAGCGCGG - Exonic
954553303 3:51499768-51499790 CGCCGGGCTTGGGGGAGGGGCGG - Intronic
954581796 3:51707002-51707024 GGCCGGGGCCGGGGGCGGGGCGG + Intergenic
954663331 3:52237601-52237623 CACCAGGGCTGGAGGCTGGGAGG + Intronic
954669115 3:52278675-52278697 CGCCGGGAAAGGGGGCGGGGCGG + Intronic
955042020 3:55327078-55327100 CACTGGGACTGGGGGCGGGGTGG - Intergenic
955228438 3:57079309-57079331 GGGCGGGGCCGGGGGCGGGGAGG + Intronic
955356675 3:58237800-58237822 CGCCGGAGCTGGGAGCGGCGCGG + Exonic
955818796 3:62874852-62874874 CGCCGGCGCCGGAGCCGGGGTGG - Exonic
956195610 3:66651098-66651120 CAGCGGGGATGGCGGGGGGGGGG + Intergenic
956605062 3:71065260-71065282 GGCCGGGGCTGCCGGCGGGGCGG + Intronic
956813648 3:72888410-72888432 CTCCCGGGCTGGCCCCGGGGAGG - Exonic
958502999 3:94938044-94938066 AGCCGGGACTGGCAGCGGGCGGG + Intergenic
959085748 3:101849440-101849462 GGCCGGGCCGGGCGCCGGGGAGG + Intronic
961182359 3:124886983-124887005 CGCCGGGGCCCGCGGCATGGTGG + Exonic
961320098 3:126067094-126067116 GGCCGGGGCGGGGGGCGGGGGGG - Intronic
961648986 3:128408121-128408143 GGCCCGGGCTGGCCGTGGGGAGG + Exonic
962277954 3:134030034-134030056 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
962318558 3:134373660-134373682 CGCCCGGGCTCGTGGTGGGGCGG - Intronic
962808905 3:138945793-138945815 CGGTGGGGCAGGCGGCGGTGCGG + Exonic
963939565 3:151085894-151085916 GGCTGGGGCTGGCGGCGGCGGGG - Intronic
964801594 3:160564925-160564947 GGCCGGGCCGCGCGGCGGGGAGG - Intronic
966596253 3:181726701-181726723 AGCCGGGGCTGGCGTGGAGGGGG + Intergenic
966787850 3:183636467-183636489 AGCCGGGGCGGGCGGGGGAGCGG + Intronic
966849733 3:184156801-184156823 CGCTGGGCCTGGAGGCGGTGGGG + Intronic
966874565 3:184314851-184314873 GGCCGGGCCTGGCTGCTGGGTGG + Intronic
967170348 3:186818259-186818281 TGCAGGGGCAGGCAGCGGGGTGG + Intergenic
967847842 3:194058252-194058274 GGCTGGGGCTGGGGCCGGGGCGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968047353 3:195631726-195631748 TGCCCGGGGTGGCGGGGGGGCGG - Intergenic
968090524 3:195895840-195895862 CGCCGGGGCAGGCTGGGGGCGGG - Intronic
968213342 3:196867798-196867820 CCCCGGGTCGGGAGGCGGGGCGG + Intergenic
968307260 3:197658198-197658220 TGCCCGGGGTGGCGGGGGGGCGG + Intergenic
968433856 4:575290-575312 CGGCGCGGCAGGCGGAGGGGAGG - Intergenic
968506527 4:973585-973607 CGCAGGCGCGGGCCGCGGGGCGG + Intronic
968671900 4:1856409-1856431 CGCCGGGGCTCGCAGCGTGGCGG + Intergenic
969360088 4:6657877-6657899 CGCGGCGGCTGGCAGCGGGAAGG + Intergenic
969436590 4:7192609-7192631 CAGCGGAGCCGGCGGCGGGGCGG - Exonic
969655816 4:8497908-8497930 CACTGGGGCTGGCGTGGGGGGGG + Intergenic
969708994 4:8831953-8831975 AGCGGGGGCTGGGGGCCGGGAGG + Intergenic
969873172 4:10116979-10117001 GGCCGGGGCCGGCGGGGGAGGGG - Intergenic
970202871 4:13627473-13627495 CCCCGGGGCTGGCCCCGGCGCGG - Exonic
970897137 4:21117288-21117310 GGCCGGGGTTGCCGGGGGGGGGG + Intronic
971617547 4:28812008-28812030 AGCCGGGAGTGGCGGCGGGCGGG - Intergenic
971635137 4:29047796-29047818 CGGCGGGGGCGGCGGCTGGGGGG - Intergenic
972533069 4:39977600-39977622 CGCTGGGGCTGGCGGTGCCGAGG + Exonic
972551883 4:40141724-40141746 GGCCAGGGCAGGCGGCTGGGAGG + Intronic
972552742 4:40148087-40148109 GGCCAGGGCAGGCGGCTGGGAGG + Intronic
975166874 4:71187240-71187262 CGCCGGGGTTGGAGGCTGGGGGG - Intergenic
975986174 4:80202899-80202921 CGCCGGGGCCGCAGGCGGCGCGG + Exonic
976765258 4:88592349-88592371 GGCACGGGCTGGAGGCGGGGCGG - Intronic
977693779 4:99946258-99946280 AGCCGGGGCTGGGGCCAGGGCGG + Intronic
978072585 4:104491454-104491476 GGGCGGGGGCGGCGGCGGGGGGG - Exonic
978620073 4:110628998-110629020 CGCGGGGGGTGGGGGAGGGGAGG + Intronic
979134020 4:117085626-117085648 CCCCGGGCCTGGCGCCGGGTAGG - Intergenic
981491591 4:145346221-145346243 TGGCGGGGCTGGCGGGGCGGCGG + Intergenic
981782628 4:148444765-148444787 CGCCGCCGCTGGGGGCGGGCGGG - Intergenic
982042363 4:151409026-151409048 AGGCGGGGCCGGCGGCGGCGGGG + Intergenic
982292115 4:153790937-153790959 GGCCGGGGCCGGCGGGGGGTTGG - Intergenic
983238782 4:165207994-165208016 CGCCGGGGCCGGCGGGAGGTGGG + Intronic
983904449 4:173169251-173169273 CGCCGGGACTGCGGGCGGAGCGG + Intronic
984206484 4:176792815-176792837 CGGGGCGGCTGGCGGCGGCGGGG + Intergenic
984438642 4:179736854-179736876 CACCGGGGCTTGTGGTGGGGTGG - Intergenic
984801831 4:183723079-183723101 GGCGGGTGCTGGCGGCGGCGGGG - Intergenic
985068390 4:186144825-186144847 CGCCGGCGCGGGCGGGGCGGAGG + Exonic
985073655 4:186191801-186191823 CGCCCCGGCTGGCGGCCGCGGGG - Exonic
985451715 4:190066656-190066678 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
985452703 4:190069948-190069970 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
985453690 4:190073245-190073267 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
985454679 4:190076538-190076560 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
985455668 4:190079831-190079853 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
985456651 4:190083125-190083147 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
985457639 4:190086425-190086447 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
985458626 4:190089718-190089740 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
985459615 4:190093018-190093040 CGCAGGGACTGGGGGCGGGCGGG + Intergenic
985595179 5:784755-784777 GGGCGGGGCTGGGGGCGGGGCGG - Intergenic
985762951 5:1761018-1761040 CGCCGGGCCAGGCCCCGGGGCGG + Intergenic
986708650 5:10471591-10471613 CCCCTGGGCTGGCTGCGGTGGGG + Intronic
986733279 5:10650136-10650158 GGCCGGGGCTGGGGCCGGGGCGG + Exonic
987132588 5:14872329-14872351 TGGCCGGGCTGGCGGCGGGCGGG + Intergenic
990351192 5:54918555-54918577 CACCGGGGCCTGCGGGGGGGTGG + Intergenic
990557653 5:56951917-56951939 TGGCGGGGCTGGCCGGGGGGCGG - Intronic
990825436 5:59893365-59893387 CGGCGGGGGCGGCGGCAGGGGGG + Exonic
991371610 5:65925708-65925730 CGGCGGGGGCGGGGGCGGGGCGG - Intergenic
991474408 5:67004251-67004273 GGCCGGGGCTGGTGGGGGGTGGG + Intronic
992470221 5:77044216-77044238 GGCCAGGGCAGGCGGCTGGGAGG + Intronic
992474269 5:77087130-77087152 GGCCGGAGCCGGCGGCGGGTCGG + Exonic
992796078 5:80256095-80256117 AGGCGGGGCCGGCGGCGGGGCGG - Intergenic
994549548 5:101213329-101213351 TGCCGCGGGTGGGGGCGGGGCGG + Intergenic
994623158 5:102187255-102187277 CACCAGGGCTGGCTGGGGGGTGG - Intergenic
995022370 5:107381031-107381053 GGCCAGGGCTGGGGGTGGGGCGG + Exonic
996379052 5:122845534-122845556 CAGCGGGGCGGGAGGCGGGGCGG + Exonic
997162062 5:131619314-131619336 CGGCGGGGCTGGAGGGCGGGGGG + Intronic
998168464 5:139857999-139858021 AGCCTGGGCTGGGGGCAGGGTGG - Intronic
998366852 5:141637560-141637582 CGCCGTGGCAGGCGGGGGGAGGG - Exonic
998399229 5:141839492-141839514 AGCTGGGGCTGGAGGTGGGGAGG + Intergenic
998521129 5:142801684-142801706 GGCGGGGGCTGGGGGAGGGGTGG - Intronic
999133173 5:149299841-149299863 AGCCAGGGCTGTCGGTGGGGAGG - Intronic
999300109 5:150485871-150485893 CCCCGGGGCGGGGGCCGGGGCGG - Intronic
1001065114 5:168529685-168529707 GGCCGGGGCCGGGGGCGCGGCGG + Exonic
1001266548 5:170278401-170278423 TGCAGGGGTTGGGGGCGGGGGGG + Intronic
1002099719 5:176851422-176851444 CGCCAGAGCTGGGGCCGGGGTGG - Intronic
1002140365 5:177133963-177133985 CGCTGGGGTGGGCGGCGGGCAGG + Intronic
1002160718 5:177312517-177312539 CGCAGGCGCCGGCGGAGGGGCGG + Intronic
1002161351 5:177315565-177315587 AGCTGGGGTTGGCGGGGGGGGGG - Intergenic
1002317896 5:178356193-178356215 CGCCTGGGGTTGCGGAGGGGAGG + Intronic
1002517012 5:179766263-179766285 GCCCGGGGCTGGTGCCGGGGTGG - Exonic
1002580839 5:180208841-180208863 CGCCGGGACTGGAGGCGCGGGGG - Intronic
1002591067 5:180291966-180291988 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
1002682937 5:180982181-180982203 AGCCGGGCCCGGCGGCGGGCAGG + Intergenic
1002691459 5:181053318-181053340 TACCGGCGCGGGCGGCGGGGCGG + Intronic
1002771274 6:292442-292464 CGGCGGGGCGGGCGGGGAGGAGG - Exonic
1002888168 6:1313414-1313436 GGCGGGCGCGGGCGGCGGGGCGG - Exonic
1002927098 6:1611031-1611053 GGCGGGGGCTGGCGGCCGGGCGG - Exonic
1002928127 6:1616813-1616835 GGCCGGGGTTGGGGGAGGGGGGG - Intergenic
1003112059 6:3258960-3258982 TGGCGGGGCTGGCAGCGGCGAGG + Exonic
1003112123 6:3259213-3259235 CGAGGGTGCGGGCGGCGGGGCGG + Intronic
1003178511 6:3771873-3771895 CGCGGGAGCCCGCGGCGGGGCGG - Intergenic
1003645587 6:7910829-7910851 CTCCGGGGCGGGGCGCGGGGCGG - Intronic
1003735752 6:8876093-8876115 AGCTGGGGCTGGGGGCAGGGCGG + Intergenic
1004044737 6:12012599-12012621 AGCTGGGGAGGGCGGCGGGGCGG + Intronic
1004044869 6:12013092-12013114 CGGCGGAGCAGGCGGCGAGGAGG + Intronic
1004070243 6:12291223-12291245 TGCGGGGGGTGGTGGCGGGGGGG - Intronic
1004193978 6:13487715-13487737 ACCCGGAGCTGGCGGCGGCGGGG - Intergenic
1004529374 6:16439358-16439380 GGGCGGGGCCGGGGGCGGGGCGG + Intronic
1004562121 6:16760983-16761005 CGCAGGGGCGGCCGGCGGGGGGG - Intronic
1004690194 6:17987197-17987219 CGGCGCGGCTGGCGGGCGGGCGG - Intronic
1004924034 6:20402277-20402299 CGCCGGGGGTGGGGAGGGGGCGG + Exonic
1004924126 6:20402640-20402662 CGCCGGGGCTGGGGACGGTGGGG - Intronic
1005348325 6:24911098-24911120 CGGCGGAGCGGGCGGAGGGGCGG + Intronic
1005915234 6:30345408-30345430 CCACGGGGCGGGCGGCGGGCGGG + Intronic
1005929722 6:30474841-30474863 GGCCAGGGCAGGCGGCTGGGAGG - Intergenic
1006256782 6:32838499-32838521 CGCCGCGGCAGGCGGGGGTGGGG - Intronic
1006502137 6:34465915-34465937 CGCCGGGGGTGGCGGGTGGCGGG - Intergenic
1006503489 6:34473216-34473238 AGACGGGGCGGGGGGCGGGGGGG + Intronic
1006535611 6:34696650-34696672 CCCCGGGCCCGGCGGCGCGGCGG - Exonic
1006834028 6:36986077-36986099 AGCCGGAGCTCGCGGCGGAGCGG - Exonic
1006860764 6:37170369-37170391 TGCCGGGACTGGCGGCGGGAGGG - Exonic
1007371103 6:41427611-41427633 CCCCGGGGCAGGCCGGGGGGAGG - Intergenic
1007414110 6:41682288-41682310 CGCCGCGGCTGGTGGGGGTGGGG - Intergenic
1007516803 6:42419251-42419273 AGCCGGGGCGGGGGGTGGGGTGG - Intronic
1007800507 6:44388147-44388169 GGCCGGGGGGGGCGGGGGGGCGG - Intronic
1007957397 6:45929982-45930004 CACGGGGGCTGGGGGCTGGGAGG + Intronic
1008369380 6:50715319-50715341 CGTCGGGGGTGACGGCCGGGTGG - Exonic
1010703236 6:79077568-79077590 CGCCGGGGCGCGGGGCGGGCGGG - Intronic
1011517114 6:88166516-88166538 CCCCAGGGCTGGCGCCGCGGCGG - Intergenic
1011640310 6:89411770-89411792 CGGCCGGGCTGGGGGCGGGAAGG + Intronic
1012470500 6:99568308-99568330 AACTGGGGCTGGGGGCGGGGAGG + Intronic
1012590607 6:100975364-100975386 CACCGGGGCTGGCTGGGGGAGGG + Intergenic
1013117737 6:107115364-107115386 GGCCGGGGGTGGGGGCGGAGGGG - Intergenic
1013272561 6:108558118-108558140 CGGCGGGGCTGGGGGCTCGGGGG - Intergenic
1013292652 6:108732490-108732512 CGTCGGGGGTGGGGGTGGGGGGG - Intergenic
1013472422 6:110476858-110476880 AGCCAGGGTGGGCGGCGGGGCGG - Intergenic
1013793683 6:113860423-113860445 CGCCGGGCCCGGCGGCGGAGGGG - Exonic
1014913186 6:127118123-127118145 CGCCGGCGCTGGGGATGGGGTGG + Intergenic
1014948066 6:127519393-127519415 CGCCCGGGCTGGGGGTGGGGAGG - Intergenic
1015820824 6:137258689-137258711 TGCTGGGGCTGGCAGTGGGGTGG + Intergenic
1016340818 6:143060475-143060497 CGCCGGGCCGGGCGAGGGGGCGG - Intronic
1016462022 6:144287021-144287043 CGCCCGGCCGGGCGGCCGGGAGG - Intronic
1016596985 6:145814480-145814502 CGCTGGCGCTGGCGGCCGTGGGG - Intronic
1016820605 6:148342932-148342954 CGCCGGGGCATGCAGCGCGGGGG + Exonic
1016936067 6:149450467-149450489 GGCCGGGGCCTGCTGCGGGGAGG - Intronic
1017671835 6:156777203-156777225 GGCCGGGGCCGGGGCCGGGGCGG - Intergenic
1017743741 6:157428630-157428652 CTCGGGGGCTAGGGGCGGGGTGG - Intronic
1017954806 6:159169258-159169280 GGCCCGGGCTGGAGGCGGGCGGG - Intergenic
1018013534 6:159693086-159693108 CGAAGGGGCTCGCGGCGGGCAGG - Intronic
1018013588 6:159693321-159693343 CGCGGGGGGGGGGGGCGGGGCGG - Exonic
1018134577 6:160767226-160767248 TGCCGGGGCGGGAGGCGGAGGGG - Intergenic
1018903105 6:168060920-168060942 TGCCGTGGCTGTCGGCGGAGTGG + Exonic
1019151828 6:170011418-170011440 AGCGGGGGCTGGCGGTGGGGAGG + Intergenic
1019159234 6:170058143-170058165 AGACAGGGCTGGGGGCGGGGCGG - Intergenic
1019189556 6:170243822-170243844 CAGCGGGGCAGGCGTCGGGGAGG + Intergenic
1019421910 7:954569-954591 CGCCCGGGATGGCGCAGGGGCGG - Intronic
1019457513 7:1138161-1138183 CGCGTGGGGCGGCGGCGGGGTGG - Exonic
1019564543 7:1672914-1672936 CGAGGGGGCCGGTGGCGGGGCGG + Intergenic
1019564672 7:1673488-1673510 ATCCGGGGCAGGGGGCGGGGAGG - Intergenic
1019606521 7:1912867-1912889 GGCCTGGGGTGGCGGCGGCGAGG + Intronic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1019989595 7:4682418-4682440 CGCGGGGGCCGGCGGGGGTGCGG - Exonic
1020105070 7:5419027-5419049 CGCCGAGGCTGAGGTCGGGGAGG - Intronic
1020130533 7:5556458-5556480 CGCTGCGGCTGCCGGCGGGCCGG - Intronic
1020177891 7:5897556-5897578 CGACGGGGGGGGGGGCGGGGGGG + Intergenic
1020262234 7:6536898-6536920 CGCCGGGGCTGGGGTGGGCGGGG + Intronic
1020273029 7:6608074-6608096 GGGCGGGGTGGGCGGCGGGGTGG - Exonic
1020282360 7:6656067-6656089 TGCCAGGGCTGGGGGCGGGTAGG + Exonic
1021614392 7:22487553-22487575 CGCCGAGGATGGCGGGGGCGGGG + Intronic
1021868260 7:24979824-24979846 CGGGGGGCCTGGCGGCGGCGCGG - Intronic
1022098086 7:27153075-27153097 CGCCTGGTCTGCAGGCGGGGTGG + Intergenic
1022139568 7:27481466-27481488 TGGCGGGGGTGGCGGGGGGGAGG + Intergenic
1022973495 7:35537309-35537331 GGGCGGGGCGGGGGGCGGGGGGG + Intergenic
1023000257 7:35801179-35801201 CGCTGGGGCTGGTCGCGGAGGGG + Exonic
1023039046 7:36156165-36156187 TGGTGAGGCTGGCGGCGGGGGGG + Intronic
1023220565 7:37916920-37916942 CGACGGGCCTGGGGGTGGGGCGG - Intronic
1023287102 7:38631389-38631411 CAGCGGGGCTGGCGGCGGCGCGG + Exonic
1024043814 7:45574448-45574470 CGCCGGGGCGGGCGGGCGGCGGG - Intronic
1024639353 7:51316835-51316857 GGGAGGGGCTGGCGGCGGCGCGG + Intergenic
1024797446 7:53036145-53036167 CGGCGGGGCGGCCTGCGGGGCGG - Exonic
1025198566 7:56949015-56949037 CGCCCGGGCAGGCGGTTGGGGGG + Intergenic
1025673385 7:63627918-63627940 CGCCCGGGCAGGCGGTTGGGGGG - Intergenic
1025793567 7:64717683-64717705 GGCCAAGGCTGGCGGCTGGGAGG - Intergenic
1025943322 7:66089008-66089030 GGCCAGGTCTGGCGGAGGGGTGG - Intronic
1026360875 7:69599749-69599771 CGGCGCGGCCGGCGGCGGCGGGG + Exonic
1026968525 7:74454528-74454550 CGCGGTGGCGGGCGCCGGGGTGG + Intronic
1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG + Intronic
1027374634 7:77537493-77537515 CGGGCGGGCGGGCGGCGGGGGGG + Exonic
1028121427 7:87059732-87059754 CGCGGGGGCGGGACGCGGGGCGG + Intergenic
1029441087 7:100586900-100586922 CCCCCGGGCTGGGGGCGGGCGGG + Intronic
1029708330 7:102286811-102286833 CGGCGGGGGCGGGGGCGGGGCGG + Intronic
1030033401 7:105388741-105388763 CGCCCGGGCTGGCCGCGTGGCGG + Intronic
1031482996 7:122300487-122300509 CCCCGGGCCTGGCGGGGTGGTGG + Intergenic
1033324031 7:140362958-140362980 GGCCGGGGCGGCCGGCTGGGCGG - Intronic
1033361332 7:140640712-140640734 CGCTGGGGCCGGGGGCGGCGGGG - Exonic
1033661990 7:143408688-143408710 CGCGGGGGTTGGGGGCGCGGGGG + Intronic
1034950989 7:155297368-155297390 CGCGGGCTCTGGCGGCGGGGAGG - Intergenic
1034985894 7:155515296-155515318 GGCCGGGGCCGGGGGGGGGGGGG - Intronic
1035265175 7:157686061-157686083 CGCCGGGGCTGAGGGCGAGGAGG + Intronic
1035284063 7:157795152-157795174 CGGCGGGGTCGGGGGCGGGGGGG + Intronic
1035403914 7:158586740-158586762 CGGCGGCGCTGCCCGCGGGGGGG + Intronic
1035404258 7:158587835-158587857 CGCCGGGGGCGGGGCCGGGGCGG - Intergenic
1035431968 7:158829358-158829380 CGGCGGGGCTGGGGGCCGCGCGG - Exonic
1035449098 7:158963930-158963952 GGCCGGGGCAGGCCGCTGGGAGG - Intergenic
1035453109 7:158991867-158991889 TGCCGGGGCTGAGGGAGGGGAGG + Intergenic
1035630188 8:1101516-1101538 TGCCGGGGCTGGGGGTGGAGGGG + Intergenic
1037273696 8:17156400-17156422 CGCCAGGGGAGGCGGCCGGGCGG + Exonic
1037801226 8:22037005-22037027 CGCGGGGGCTGGGTGCAGGGAGG - Intergenic
1037826968 8:22165393-22165415 CGCCGGGCATGCTGGCGGGGCGG - Exonic
1037876524 8:22551554-22551576 CCGCAGGGCTGGCGTCGGGGAGG - Intronic
1037882247 8:22579016-22579038 CGCCTGGGCTCGCCGCGCGGAGG + Exonic
1037917470 8:22781340-22781362 CACCGGGGCTGGGAGTGGGGAGG + Intronic
1038807996 8:30812480-30812502 GGCCGGGGCCGGGGGCGGGTGGG - Exonic
1039468901 8:37801766-37801788 GGCTGGGGCTGGCGCCGGGATGG + Intronic
1039608521 8:38901496-38901518 CGCGGGGGCTGGCGGGGCTGGGG + Intronic
1039709317 8:40040105-40040127 GGCCGGGGGTGGCAGCGGGGAGG - Intergenic
1039921668 8:41897503-41897525 CGCCGGGGATGGGGGACGGGCGG - Intergenic
1039947231 8:42140434-42140456 CGGCGGGGCCGGCGGGGGAGGGG - Intergenic
1039949015 8:42153271-42153293 CGCCGCGGCTGCGGGCGGAGGGG + Intronic
1041167365 8:55102737-55102759 CGCCGGCCCGGGCGGCGGCGGGG + Exonic
1041355247 8:56993438-56993460 CGGCGAGCCTGGCGGCGGCGCGG - Exonic
1041709201 8:60877337-60877359 CGAGGCGGATGGCGGCGGGGAGG + Intergenic
1041910709 8:63085926-63085948 AGCCGGGCCTGGCGGCGCTGCGG - Exonic
1042040128 8:64581063-64581085 CGGCGGCGGCGGCGGCGGGGTGG + Exonic
1042367480 8:67953173-67953195 AGCCGGGGCGGGGGGCGGGGGGG - Intronic
1042791971 8:72617791-72617813 GGCCGGGGCCGGCGGGGAGGTGG - Intronic
1043159591 8:76829272-76829294 AGCCGGGGCGGGGGGCGGGTAGG + Intronic
1043395036 8:79827682-79827704 CCCAGGGGCTGGTGGAGGGGAGG - Intergenic
1043997943 8:86842685-86842707 AGCGGGGGTTGGCGGGGGGGGGG + Intergenic
1044611909 8:94099751-94099773 TGCCGGGGTTGGGGGCAGGGGGG + Intergenic
1044692898 8:94896266-94896288 CGCTGGCGGCGGCGGCGGGGCGG - Intronic
1044698836 8:94948975-94948997 GGCCGGGCCCGGCGGCGGCGAGG + Intronic
1044821537 8:96158981-96159003 GCTCGGGGCTGGGGGCGGGGGGG + Intronic
1044839771 8:96327772-96327794 CCACGGGGCTGGCGGCAAGGAGG - Intronic
1045098930 8:98825861-98825883 CGGCGCGGCCGGGGGCGGGGCGG - Intronic
1045241751 8:100408689-100408711 GACCGGGGCTGGGGGTGGGGAGG + Intronic
1046397956 8:113665193-113665215 CACCGGGGCTGGTTGGGGGGTGG - Intergenic
1047262268 8:123274031-123274053 CGCGGCGGCGGGTGGCGGGGTGG - Intronic
1048009277 8:130443342-130443364 CGCCGGGACGGGGCGCGGGGCGG - Intronic
1049390560 8:142367512-142367534 CGCCGGGGCGGGGGAGGGGGAGG + Intronic
1049531493 8:143157817-143157839 CGGAGGGGCTGGGGGCAGGGCGG - Intergenic
1049537577 8:143189507-143189529 CCACGGGGGTGGGGGCGGGGAGG - Intergenic
1049550990 8:143259610-143259632 GGCCAGGGTTGGGGGCGGGGGGG - Intronic
1049569301 8:143360928-143360950 TGCAGGTGCTGGGGGCGGGGGGG + Intergenic
1049583454 8:143422786-143422808 CGCCGGGCAGGGGGGCGGGGGGG - Intronic
1049689785 8:143953444-143953466 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1049694536 8:143976910-143976932 CGGCGGGGCTGGGGCCCGGGCGG + Intergenic
1049706941 8:144047410-144047432 GGCCGGGGCTGGGTGAGGGGCGG + Intergenic
1049760273 8:144329046-144329068 CACCGGGGGTGGGGGCGTGGCGG + Intergenic
1049761468 8:144333766-144333788 CGCCGGAGGCGGGGGCGGGGCGG - Exonic
1049892507 9:83551-83573 CGCCAAGGCAGGCGGCTGGGAGG + Intergenic
1049896879 9:117388-117410 CCCCGGGACTGGCTGCGGCGGGG + Exonic
1050653652 9:7799984-7800006 GGGCGGGGGGGGCGGCGGGGAGG - Exonic
1051481944 9:17571065-17571087 GGCAGGGGTTGGCGGCGGGGAGG - Intergenic
1051936344 9:22447145-22447167 CGCCGGGGACGGGGGCGGAGGGG - Exonic
1052051046 9:23850237-23850259 CGGGGGTGCTGGGGGCGGGGGGG - Intergenic
1052265105 9:26562982-26563004 GGCCGGGGGTGGGGGGGGGGGGG + Intergenic
1053149134 9:35732012-35732034 CGCGGGGCCTGGCCCCGGGGCGG - Intronic
1053311792 9:37025238-37025260 AGCCAGGGCTGGCTGCGGGCAGG - Intronic
1053352828 9:37424721-37424743 GCCCGGGGCTGGCTGAGGGGAGG - Intronic
1053725175 9:40992089-40992111 CGCCGGTGCTGACGGTGGCGGGG - Intergenic
1053739982 9:41127640-41127662 CCCCGGGACTGGCTGCGGCGGGG + Exonic
1054442946 9:65283634-65283656 CCCCGGGACTGGCTGCGGCGGGG + Exonic
1054487334 9:65737867-65737889 CCCCGGGACTGGCTGCGGCGGGG - Exonic
1054688368 9:68303673-68303695 CCCCGGGACTGGCTGCGGCGGGG - Exonic
1056153939 9:83817197-83817219 CGCGGGCGCCAGCGGCGGGGAGG + Intronic
1056475395 9:86947231-86947253 CGGCGGCGGTGGCGGCGGCGAGG - Intergenic
1056992225 9:91423217-91423239 CTCTGGGGCTGGCGGCGTAGGGG - Intronic
1057282373 9:93722105-93722127 CGTTGGGGCTGGGGGCAGGGTGG - Intergenic
1057314600 9:93960376-93960398 CGCCGGGGCTGGCGAGCGGTGGG - Intergenic
1057592382 9:96383654-96383676 AGCCGGGGCTGGCGGGCGGCGGG - Exonic
1057605455 9:96495394-96495416 GGCAGGGGCGGGGGGCGGGGGGG - Intronic
1057752458 9:97803665-97803687 CGCCGGGGCTGGCCGCGCACAGG - Intergenic
1057921874 9:99104808-99104830 CTCCGGGGCTAGCGGCTGAGCGG + Intronic
1058437302 9:104974868-104974890 GTCGGGGGCTGGGGGCGGGGAGG + Intergenic
1058687205 9:107489488-107489510 CGCAGGGGCTGTGGCCGGGGCGG + Exonic
1059165690 9:112074429-112074451 AGCAGGGGCTGGCGAGGGGGTGG - Intronic
1059375163 9:113875973-113875995 CACTGGGGCTGGCGGACGGGAGG + Intergenic
1059455530 9:114398087-114398109 AGCTGGGGCTGGTGGCAGGGAGG - Intergenic
1059470935 9:114504717-114504739 GGCCGGGGCGGGCGGCGGCGGGG - Exonic
1060106772 9:120877417-120877439 GGCGGGGGCTGGCGGCGCTGCGG - Intronic
1060153015 9:121300644-121300666 CACTGGGGCTGGGGCCGGGGAGG - Intronic
1060301591 9:122377469-122377491 GGCCGGGGCGGGGGGTGGGGGGG - Intronic
1060359395 9:122940941-122940963 AGACGGGGCAGGGGGCGGGGCGG + Intronic
1060527515 9:124328800-124328822 CAGCGGGGCTGGCGGGGAGGGGG + Intronic
1060555318 9:124504833-124504855 GCGCGGGGCTGGCGGCGCGGGGG + Intronic
1060700669 9:125747117-125747139 CGGCGGGGCGCGCGGCGGCGAGG + Intergenic
1060713079 9:125889933-125889955 AGCCGGGGCCGCCGGCGCGGGGG - Intronic
1060770724 9:126329916-126329938 AGCCGGGGTTGGGGGCGGGGTGG - Intronic
1060811588 9:126613791-126613813 CCCCGGGGCGCGCGGGGGGGCGG + Intergenic
1060814318 9:126626773-126626795 CCGCGGGGCTGGGGGTGGGGCGG - Intronic
1060945743 9:127568717-127568739 CGCCGGGGCCGGGGGCTCGGGGG - Intronic
1060992732 9:127857981-127858003 CCCCAGGGCTGGCAGCGGCGTGG - Intergenic
1061158895 9:128882176-128882198 CGCTGCGGCCGGCGGCGGGACGG + Intronic
1061160725 9:128892475-128892497 CGCCAGGGCTGGAGGGGGAGGGG - Intronic
1061201066 9:129138843-129138865 AGCCGGGACTGACGGCTGGGCGG + Intronic
1061365800 9:130172122-130172144 CGCCAGGGCTGGATTCGGGGAGG + Intergenic
1061396467 9:130346463-130346485 CGGTGGGGCTGGAGGCAGGGGGG + Intronic
1061450649 9:130665296-130665318 AGCCGGGGCTGGGGAGGGGGTGG + Intronic
1061580116 9:131531210-131531232 CGCCGGGCCTGGGGAAGGGGCGG - Intronic
1061943534 9:133895290-133895312 TGGCGGGGCTGGGGTCGGGGAGG + Intronic
1062204125 9:135326358-135326380 GGCCTGGGCTGGCTGCGGGGAGG - Intergenic
1062379579 9:136280792-136280814 CTCCTTGGCTGGCAGCGGGGAGG - Intergenic
1062389422 9:136327986-136328008 CCGGGGGGCTGGAGGCGGGGTGG + Intronic
1062390037 9:136330200-136330222 CCCCGGGGCTGGGGCCGGGAAGG + Intronic
1062412527 9:136432223-136432245 AGCCAGGGGAGGCGGCGGGGCGG + Intronic
1062461878 9:136665721-136665743 GGGCGGGGCCGGGGGCGGGGCGG + Intronic
1062461968 9:136665964-136665986 CGCTGGGGCCGGGGGCGGAGCGG + Intronic
1062478051 9:136739166-136739188 CGCGGAGGGTGGCGGCGGCGTGG + Intronic
1062500416 9:136849679-136849701 GGGCGGGGCTGGCGGGGCGGGGG + Intronic
1062502026 9:136855751-136855773 CCCCGAGGCTGGGGGCTGGGAGG + Exonic
1062567528 9:137169952-137169974 CGCGGGTGCCGGGGGCGGGGGGG - Exonic
1062696350 9:137878002-137878024 CGGCGGGGCCGGCGGGGCGGGGG + Exonic
1203774098 EBV:63159-63181 CGCCGGGGGTGGCAGTGGAGGGG + Intergenic
1203449627 Un_GL000219v1:99801-99823 CGCCGGTGCTGACGGTGGCGGGG + Intergenic
1203470259 Un_GL000220v1:112903-112925 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1203478080 Un_GL000220v1:156875-156897 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1185503843 X:618214-618236 CCCTGGGTCTGGCAGCGGGGAGG - Intergenic
1185512012 X:670736-670758 AGACGGGGCTGGGGGGGGGGGGG + Intergenic
1185736547 X:2500652-2500674 GGCCGGGGGTGGGGGGGGGGCGG - Intronic
1185778821 X:2828870-2828892 CGCGGGGGCTGGCGGAGGCGGGG + Exonic
1186466229 X:9786339-9786361 GGCCGGGGCTGGCGGGGAGGGGG - Intergenic
1186660829 X:11665792-11665814 TGCCGGGGCTGGAGCTGGGGCGG + Intergenic
1186765632 X:12767962-12767984 CACAGGGGCTGGGGGTGGGGAGG + Intergenic
1187067424 X:15854640-15854662 CGCCGGGGATGGGGGAGAGGGGG - Intronic
1187124953 X:16446215-16446237 TGCCGGGGCTGGCGGGGTTGGGG + Intergenic
1188242673 X:27809523-27809545 GGCGGGGGCCGGCGGCGGGGGGG - Intronic
1189581940 X:42415421-42415443 TGCCGGGGCTGGAGGTGGGTGGG + Intergenic
1190114894 X:47619939-47619961 CGGCTGGGCCGGCGGCGGCGCGG + Intergenic
1190215214 X:48475468-48475490 GGGCGGGGGTGGTGGCGGGGAGG - Intergenic
1190385633 X:49879957-49879979 CGCCGGGGCCGGGGCCGGGGCGG - Exonic
1190475215 X:50820494-50820516 GGCGGGGGCGGGGGGCGGGGGGG - Intergenic
1190598967 X:52070149-52070171 CGCAGAGGCTGGGGGCGAGGCGG - Intergenic
1190609857 X:52183924-52183946 CGCAGAGGCTGGGGGCGAGGCGG + Intergenic
1191252971 X:58268162-58268184 TGCCGGGCCTGGCGGGTGGGGGG - Intergenic
1192482920 X:71500531-71500553 AGCGGGGGGTGGGGGCGGGGTGG - Intronic
1197195912 X:123700504-123700526 GGGCGGGGCTGGGGGCGGCGGGG + Intronic
1197584457 X:128328111-128328133 CGGTGGGGGTGGGGGCGGGGTGG - Intergenic
1197754517 X:129984331-129984353 GGCGGGGGCAGGCGGGGGGGTGG + Intronic
1198321363 X:135521417-135521439 CGGCGGGGCGGGCGGCGAGGGGG + Intronic
1199736955 X:150693765-150693787 CGCAGGGCCTGGCGGTGGCGGGG + Intronic
1199832977 X:151562857-151562879 CGGGGGGGCGGGGGGCGGGGGGG + Intergenic
1200065590 X:153502850-153502872 CTCCGGGGCTGGCTGCGGAAAGG + Intronic
1200080851 X:153575634-153575656 CCACGGGGCTGGGGCCGGGGGGG + Intronic
1200147733 X:153935161-153935183 GGGCGGGCCTGGGGGCGGGGCGG + Exonic
1200209658 X:154341606-154341628 GGCCGGGGCCGGGGCCGGGGCGG + Intergenic
1200221194 X:154390486-154390508 GGCCGGGGCCGGGGCCGGGGCGG - Intronic
1200829128 Y:7673407-7673429 AGCCGGGGCTGGCGGGGGGAGGG - Intergenic
1201959365 Y:19661663-19661685 AACCGGGGCGGGGGGCGGGGGGG + Intergenic