ID: 1158650091

View in Genome Browser
Species Human (GRCh38)
Location 18:59276295-59276317
Sequence TAGCCCCTAACAATGACCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158650091_1158650096 23 Left 1158650091 18:59276295-59276317 CCGGGGGTCATTGTTAGGGGCTA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1158650096 18:59276341-59276363 ACTCGATTAGGGAAGATGAATGG 0: 1
1: 0
2: 1
3: 7
4: 106
1158650091_1158650093 12 Left 1158650091 18:59276295-59276317 CCGGGGGTCATTGTTAGGGGCTA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1158650093 18:59276330-59276352 ATTTCCCAAGAACTCGATTAGGG 0: 1
1: 0
2: 0
3: 8
4: 86
1158650091_1158650098 29 Left 1158650091 18:59276295-59276317 CCGGGGGTCATTGTTAGGGGCTA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1158650098 18:59276347-59276369 TTAGGGAAGATGAATGGACTGGG 0: 1
1: 1
2: 7
3: 25
4: 244
1158650091_1158650097 28 Left 1158650091 18:59276295-59276317 CCGGGGGTCATTGTTAGGGGCTA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1158650097 18:59276346-59276368 ATTAGGGAAGATGAATGGACTGG 0: 1
1: 0
2: 6
3: 12
4: 216
1158650091_1158650092 11 Left 1158650091 18:59276295-59276317 CCGGGGGTCATTGTTAGGGGCTA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1158650092 18:59276329-59276351 TATTTCCCAAGAACTCGATTAGG 0: 1
1: 0
2: 0
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158650091 Original CRISPR TAGCCCCTAACAATGACCCC CGG (reversed) Intronic
906790499 1:48654926-48654948 TAGCCCCTAACAAGGGCGCCTGG - Intronic
907097029 1:51791349-51791371 AAGCCCCACACAATGACCACAGG + Intronic
907511919 1:54967822-54967844 TAGGCCTTAACAATGAACCTCGG - Intergenic
907696138 1:56731159-56731181 TAGCCTCACACACTGACCCCTGG + Intronic
908767931 1:67570905-67570927 GGGCCCCTAATAATGACCCTGGG + Intergenic
908798850 1:67858208-67858230 TAGTCCCTTACAATGACACCAGG + Intergenic
920591970 1:207228815-207228837 TCGCCCCTAACGAGGCCCCCTGG + Intergenic
1069753619 10:70760535-70760557 AAGCCCCTTACCAGGACCCCAGG + Exonic
1073122344 10:101130443-101130465 TTCCACCTAACAATTACCCCAGG - Intronic
1085955574 11:81389582-81389604 TAGCCTCTAAGAAAGACTCCAGG - Intergenic
1086983473 11:93223828-93223850 CAGCCCCTGACACTGGCCCCAGG - Intergenic
1087362921 11:97183529-97183551 TAACCCCTAACAATGACAATGGG + Intergenic
1090630658 11:128644383-128644405 TGGCCCCTAGCACTGACCACTGG + Intergenic
1090752957 11:129763550-129763572 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1094637151 12:32237537-32237559 TAGCCCCTAACAAGAGCCCAAGG - Intronic
1095508842 12:42927467-42927489 TAGACCCTATCAATGACTTCAGG - Intergenic
1106783998 13:33089144-33089166 TAGCCTCTAAGAGTGACCTCAGG - Intergenic
1113473761 13:110564999-110565021 TAGCCCCTGACAATGACTAACGG + Intergenic
1113582513 13:111439087-111439109 GAGCCCCAAACAATGAGGCCTGG - Intergenic
1116813929 14:49566380-49566402 TGGTCTCTAACAATGACCTCAGG - Intergenic
1121351190 14:93174477-93174499 TAGGTCCTCACAATGACCCCTGG + Intergenic
1124819283 15:33028253-33028275 TATCCCCAAACAGTGACACCTGG + Intronic
1128690323 15:69719768-69719790 CAGCCCCTCACAAGGACACCTGG + Intergenic
1131058658 15:89391217-89391239 TAGCCCTTCAGAATAACCCCAGG + Intergenic
1131754496 15:95545237-95545259 AAGCCCCTTACCAAGACCCCGGG + Intergenic
1132659119 16:1053783-1053805 CAGCCCCTCCCACTGACCCCAGG + Intergenic
1133906411 16:10026696-10026718 CAGCTCTTAACAATGGCCCCAGG + Intronic
1139182582 16:64765523-64765545 TAGGCCCTGCCAATAACCCCTGG + Intergenic
1141064514 16:80903048-80903070 TCGCTGCAAACAATGACCCCAGG + Intergenic
1143120415 17:4603092-4603114 TACCCTCTGATAATGACCCCTGG - Intronic
1144002037 17:11064192-11064214 TAGCCCCTGACAATCAGCCAAGG - Intergenic
1146573277 17:33970627-33970649 CAGCCCCTAACACAGACCCAGGG + Intronic
1146627181 17:34443722-34443744 CAGCCTCTGAGAATGACCCCTGG - Intergenic
1148193080 17:45693375-45693397 TAGAGTCTTACAATGACCCCAGG + Intergenic
1148814651 17:50318896-50318918 TACCCCCTGGCAAGGACCCCAGG + Intergenic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1150332230 17:64303613-64303635 TAGCCCCTCACAAAGTCTCCAGG - Intergenic
1158650091 18:59276295-59276317 TAGCCCCTAACAATGACCCCCGG - Intronic
926613842 2:14975024-14975046 TAGTAGCTAAGAATGACCCCTGG + Intergenic
927440555 2:23113396-23113418 TAGACCCTAACCATCACCCTTGG - Intergenic
932755597 2:74407085-74407107 TAGCCCCACACAGTGACCTCTGG - Intergenic
938689122 2:133770673-133770695 TAGCCCCTAAAAATGACTGATGG + Intergenic
948594849 2:239073316-239073338 CAGCCCCTAACGATGGCCCTCGG - Intronic
1171422361 20:25025709-25025731 TAGTCGCTGAGAATGACCCCTGG - Intronic
1177661133 21:24085467-24085489 CAGCCCCGACCAAGGACCCCTGG - Intergenic
1178807554 21:35851985-35852007 CAGCCCATAACAATGGCCCTGGG - Intronic
1182232103 22:28846124-28846146 TTGCCCCAAAAGATGACCCCAGG - Intergenic
1182700275 22:32231270-32231292 TAGCCCCTTGCACTGACCCATGG + Intronic
1183629875 22:39026491-39026513 TAGCCCATGACAATGACCCAGGG + Intronic
1184134527 22:42539160-42539182 CAGCCCCTAAGAATCACCACAGG + Intergenic
950231401 3:11279097-11279119 TAGCCCCATGCAAGGACCCCTGG - Intronic
952077930 3:29720851-29720873 TAGCCCCAGACAATGACAGCAGG - Intronic
954577392 3:51684145-51684167 TAACCCCTCACTATGATCCCTGG + Intronic
956037065 3:65105180-65105202 TAGCCCCTAATAATGAGAGCTGG - Intergenic
956204798 3:66743863-66743885 CAGCCCCTAACCATGACTCACGG + Intergenic
958718459 3:97816319-97816341 TTGCCCCTTACCATGACCTCTGG - Intergenic
958879033 3:99648583-99648605 TAGCCCTTAAAAATTACCCTAGG - Intronic
960476205 3:118131982-118132004 TATCCCCTAATAAAGACTCCTGG + Intergenic
961437057 3:126926535-126926557 TCTCCACTCACAATGACCCCTGG - Intronic
961672808 3:128547283-128547305 TACCACCTAACCATGATCCCTGG - Intergenic
963598015 3:147353173-147353195 TAGCCCCTGACAAGGTGCCCAGG - Intergenic
969326580 4:6447722-6447744 TAGACCCTGACTTTGACCCCAGG - Intronic
975372101 4:73600848-73600870 TATCCTATGACAATGACCCCAGG - Intronic
982206778 4:153002465-153002487 AAGACCCTGACAATGACCTCAGG - Intergenic
983204909 4:164902098-164902120 CAGCCCCTACCCCTGACCCCAGG + Intergenic
986346791 5:6843386-6843408 TTGCCTCTAAGAATCACCCCAGG - Intergenic
987941184 5:24540140-24540162 CAGCCCCTAAAAAAGCCCCCAGG + Intronic
989038069 5:37196435-37196457 CAGCCCCTAATAATGACTCTAGG + Intronic
990435370 5:55784699-55784721 TAGCCCCTAATAAAAACCCTGGG + Intronic
997329693 5:133051293-133051315 TAGGCCCTAACAAGGAACACAGG - Intergenic
1002344496 5:178537930-178537952 TAGCCCCTGGCACTCACCCCAGG + Intronic
1004958493 6:20757468-20757490 AACCCCCTACCAAAGACCCCGGG + Intronic
1006593308 6:35173923-35173945 TGGCCCCCAGCAATCACCCCTGG - Intergenic
1006598510 6:35210914-35210936 TAGGGCCTAACAATGATCTCAGG + Intergenic
1006602482 6:35235315-35235337 TAGCCCCAAATGATGAGCCCTGG - Intronic
1007810979 6:44485476-44485498 AAGCCCTTAAAAATGACCCTGGG - Intergenic
1007814233 6:44509154-44509176 CTGGGCCTAACAATGACCCCAGG + Intergenic
1009678951 6:66865998-66866020 CAGCCCTTAACAATGATCCAAGG - Intergenic
1010829080 6:80508965-80508987 TAGCCCTTAACAATAACTGCAGG - Intergenic
1011869900 6:91880869-91880891 TGGCCCCTAACACTGATCTCGGG + Intergenic
1022445230 7:30464938-30464960 TTGGCGGTAACAATGACCCCTGG - Intronic
1028169842 7:87582897-87582919 TATCCTCCAACTATGACCCCTGG - Intronic
1028699692 7:93762886-93762908 CAGCCCCTAACTATGGCTCCTGG - Intronic
1047673791 8:127177599-127177621 TGGCCCCTTACAATGTCTCCAGG + Intergenic
1052894514 9:33734803-33734825 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1061728992 9:132598580-132598602 TACCCCGTTACAATGACCACTGG + Intronic
1062340897 9:136093685-136093707 TACCACCCAACAGTGACCCCAGG + Intronic
1186943570 X:14540044-14540066 TAGCACCTAACAATGGTACCTGG - Intronic
1189682878 X:43535076-43535098 TAGCCCCTCACAACTTCCCCAGG + Intergenic
1197855482 X:130909834-130909856 TAGCCCCTAAGTCTGTCCCCAGG - Intergenic