ID: 1158652293

View in Genome Browser
Species Human (GRCh38)
Location 18:59299009-59299031
Sequence CTCCGGAGGCTGGCGCGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158652293_1158652305 17 Left 1158652293 18:59299009-59299031 CCACTCCGCGCCAGCCTCCGGAG 0: 1
1: 0
2: 1
3: 16
4: 243
Right 1158652305 18:59299049-59299071 CTGCTCTTGGCCAGGGCCTTGGG 0: 1
1: 1
2: 6
3: 53
4: 461
1158652293_1158652299 9 Left 1158652293 18:59299009-59299031 CCACTCCGCGCCAGCCTCCGGAG 0: 1
1: 0
2: 1
3: 16
4: 243
Right 1158652299 18:59299041-59299063 GCCTCTCCCTGCTCTTGGCCAGG 0: 1
1: 6
2: 3
3: 53
4: 425
1158652293_1158652301 10 Left 1158652293 18:59299009-59299031 CCACTCCGCGCCAGCCTCCGGAG 0: 1
1: 0
2: 1
3: 16
4: 243
Right 1158652301 18:59299042-59299064 CCTCTCCCTGCTCTTGGCCAGGG 0: 1
1: 0
2: 3
3: 68
4: 467
1158652293_1158652298 4 Left 1158652293 18:59299009-59299031 CCACTCCGCGCCAGCCTCCGGAG 0: 1
1: 0
2: 1
3: 16
4: 243
Right 1158652298 18:59299036-59299058 GTGAAGCCTCTCCCTGCTCTTGG 0: 1
1: 0
2: 3
3: 31
4: 288
1158652293_1158652304 16 Left 1158652293 18:59299009-59299031 CCACTCCGCGCCAGCCTCCGGAG 0: 1
1: 0
2: 1
3: 16
4: 243
Right 1158652304 18:59299048-59299070 CCTGCTCTTGGCCAGGGCCTTGG 0: 1
1: 1
2: 3
3: 56
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158652293 Original CRISPR CTCCGGAGGCTGGCGCGGAG TGG (reversed) Intronic
900100261 1:959457-959479 CTACGGAGCCGGGCGCCGAGCGG - Intergenic
901381776 1:8878992-8879014 CTCCGGGGGATGGCCCGGGGCGG + Intronic
906353936 1:45086618-45086640 CCCCGGGGGCTGTCGCGGGGTGG + Intronic
908271385 1:62425688-62425710 CTCAGGAGGCTGGGGCAGGGAGG + Intergenic
908611443 1:65865416-65865438 CTCTGGGGGGTGGCGGGGAGGGG + Intronic
911648119 1:100356968-100356990 CACAGGAGGGTGGCGTGGAGGGG + Intronic
914255770 1:145960605-145960627 CTCCTGGGACTGGCGCGGAGAGG + Exonic
915519906 1:156436123-156436145 CTCCGGCCGCGGGCGCGGCGGGG + Intergenic
915592925 1:156880700-156880722 CCCCGGAGGCTGGTGGGGTGGGG + Intronic
915931275 1:160062241-160062263 CTCCGGACACTGGGGCGAAGGGG + Intronic
917661582 1:177181916-177181938 CCCCGGAGGTTGCCGAGGAGTGG + Intronic
921957294 1:220998018-220998040 CTCCAGAGGCAGGCTGGGAGGGG - Intergenic
924172418 1:241356680-241356702 CTCCGGCGGCCGCCGCGGCGCGG - Intronic
924511294 1:244730816-244730838 CTCCGGATCCCCGCGCGGAGGGG + Intergenic
1064537631 10:16374092-16374114 CTCTGGAGGCTGGAGTGCAGTGG - Intergenic
1065756309 10:28934467-28934489 CTCCGGAGGCCGAGGCTGAGTGG - Intergenic
1067765074 10:49079309-49079331 CTCAGGAGGCTGAGGCGGAAAGG - Intronic
1069962847 10:72088447-72088469 CTCCGGTGACTGGCGGAGAGTGG + Exonic
1070525266 10:77290906-77290928 CTCATGAGGCTGGCCAGGAGGGG + Intronic
1072356331 10:94615364-94615386 CTTGGGAGGCTGACGCGGAATGG - Intergenic
1072656762 10:97335005-97335027 CCCAGGAGGCGGGCCCGGAGTGG - Intergenic
1073084957 10:100882412-100882434 CTCGGGGGGCTGGTGGGGAGGGG + Intergenic
1074104197 10:110376467-110376489 CGCCGGAGGCAGGAGGGGAGTGG - Intergenic
1074715622 10:116215882-116215904 CTCCAGGGGCTGGTGGGGAGAGG - Intronic
1075521779 10:123147818-123147840 CTCCAGAGGCAGGGGCGGTGCGG - Intergenic
1077166231 11:1140669-1140691 CTCCGGAAGGTGGAGAGGAGAGG + Intergenic
1077636642 11:3846290-3846312 CTCCTGAGGCTGGCTGAGAGAGG - Intergenic
1079674831 11:23213467-23213489 CTCAGGAGGCTGGAGTGCAGTGG - Intergenic
1079773646 11:24496827-24496849 CTCCCCAGGATGGCGCGGGGCGG - Intergenic
1082081918 11:48018925-48018947 CTCTGCAGGCTGGTGGGGAGGGG + Intronic
1082168033 11:48968891-48968913 CCCCAGAGGCCGGCGCGGAAGGG - Intergenic
1082175162 11:49049880-49049902 CTGCGGACGCTGGTGCGGTGTGG - Intergenic
1082235512 11:49817745-49817767 CCCCAGAGGCCGGCGCGGAAGGG + Intergenic
1082802797 11:57426940-57426962 GTGCGGAGGCTGGCGGGGAGCGG - Intronic
1084010801 11:66347335-66347357 CTCCAGAGGCCAGCGCGGTGCGG + Exonic
1084124796 11:67092206-67092228 CACCGGAGCCTGTCGGGGAGTGG - Intergenic
1084264463 11:67997733-67997755 CTGCGGACGCTCCCGCGGAGCGG - Exonic
1084443966 11:69192657-69192679 TTCCGGAGGCTGGGGAGGCGGGG + Intergenic
1084457558 11:69277266-69277288 CTCCGGAGGCTGGAGAGGCCAGG - Intergenic
1084554715 11:69868833-69868855 GTGCGGAGGCTGGGGCTGAGCGG - Intergenic
1085456926 11:76670685-76670707 CCCCGGGGTCTGGCGCGGGGTGG - Intronic
1088653384 11:111977309-111977331 ATCCGGAAGGTGGCACGGAGTGG + Intronic
1091498900 12:996191-996213 CTCCGGAGGCTGAGGCAGAATGG - Intronic
1091599269 12:1908217-1908239 TCCAGGAGGCCGGCGCGGAGAGG + Intronic
1091971152 12:4788155-4788177 GGCCGGGGGCTGGCGGGGAGGGG + Intronic
1095200719 12:39380611-39380633 CTCAGGAGGCTGAAGAGGAGAGG + Intronic
1097124800 12:56765617-56765639 CTCTGGAGGCTGACACGGTGGGG - Intronic
1099131575 12:78840032-78840054 CTCCGGAGGCTGAGGCAGAATGG - Intergenic
1099462426 12:82940123-82940145 CTCCGGAGGCTGAGGCAGAATGG - Intronic
1100248463 12:92789549-92789571 CTTCTGAGCCTGGCTCGGAGAGG + Intronic
1102288356 12:111678142-111678164 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1103622049 12:122193088-122193110 GTCCTGAGGCTGGCGGGGCGCGG + Intronic
1104689968 12:130818371-130818393 CTCTGGAGGGTGGGGGGGAGAGG + Intronic
1113541881 13:111115496-111115518 CCCGGGAGGCAGGCGGGGAGGGG - Exonic
1114193972 14:20461187-20461209 CTCCGTACGGTGGTGCGGAGGGG + Exonic
1114364887 14:22015144-22015166 CTCTGGAGGCTGGAGTGCAGTGG + Intergenic
1115562518 14:34596110-34596132 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1115662971 14:35515541-35515563 CTCGGGAGGCTGAGGCAGAGTGG - Intergenic
1115813591 14:37137103-37137125 CTCAGGAGGCTGAGGCAGAGTGG - Intronic
1119046273 14:71320955-71320977 TTCCCGAGGCTGGCTCCGAGGGG - Intronic
1119527565 14:75334280-75334302 CTGCGGAGTCAGGCGCGGAGGGG - Intergenic
1121293193 14:92794379-92794401 CCTCGGCGGCTGGCCCGGAGGGG - Exonic
1121569389 14:94936150-94936172 CTCCGAGGGCTGGTGCTGAGCGG - Intergenic
1121696068 14:95913323-95913345 CACCGGAGCCTGTCGGGGAGTGG - Intergenic
1122493707 14:102137163-102137185 CTCCGCAGGCTGGAGTGCAGTGG - Intronic
1122569339 14:102683983-102684005 CTGCGGGGGCTGGGGCGGAGAGG - Intronic
1123066392 14:105621545-105621567 TTCAGGAGGCTGGCGTGGACGGG + Intergenic
1123070531 14:105640597-105640619 TTCAGGAGGCTGGCGTGGACAGG + Intergenic
1123089771 14:105737385-105737407 TTCAGGAGGCTGGCGTGGACGGG + Intergenic
1123095562 14:105765545-105765567 TTCAGGAGGCTGGCGTGGACGGG + Intergenic
1124121742 15:26894092-26894114 GGCCGGAGGCTGGAGCGCAGCGG + Intronic
1125318189 15:38454488-38454510 ATCCGCCGGGTGGCGCGGAGCGG + Intronic
1125503421 15:40253065-40253087 GTCGGGAGGCGGGCGCGGAGCGG + Intronic
1129332412 15:74834468-74834490 GTCCGGAGGCTGGGGCGAGGGGG - Intergenic
1129776914 15:78242929-78242951 CTCAGGAGGCTGAAGCGGGGAGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132053696 15:98633350-98633372 CTCGGGAGGCTGGGGTGGGGAGG + Intergenic
1132700533 16:1220300-1220322 CTCCGGTGGCCGGCGGCGAGCGG + Exonic
1132815915 16:1826537-1826559 GCGCTGAGGCTGGCGCGGAGCGG - Intronic
1132989325 16:2784972-2784994 CTCCGGAGGCTGGGGAGGCTGGG + Intronic
1133287420 16:4697126-4697148 CTCCTGAGCCTGGCCGGGAGAGG - Intronic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1135082534 16:19448964-19448986 CTCGGGAGGCTGGGGCAGAATGG - Intronic
1135679483 16:24444234-24444256 CTCGGGAGGCTGGCGGGGGAAGG + Intergenic
1135775886 16:25257506-25257528 CTCCCGGGTCGGGCGCGGAGAGG + Exonic
1136146968 16:28321508-28321530 TTCTGGAGGCTGGAGGGGAGAGG + Exonic
1136544652 16:30948497-30948519 CCCCGGAGGCCTGCGCGGAGGGG - Exonic
1137476933 16:48817367-48817389 CTCTGCAGGCTGGCTGGGAGTGG - Intergenic
1139952812 16:70680246-70680268 CGCAGGAGGCTGGCGCGGCTGGG - Intronic
1142024646 16:87806015-87806037 CTCCGGAGGATGGTGGGGTGAGG + Intergenic
1142659453 17:1417768-1417790 CTCCGGAGGCCGAGGCAGAGTGG - Intergenic
1143140522 17:4739659-4739681 CTCCGGCGGCGGGCGAGGAGGGG + Exonic
1145111296 17:20164265-20164287 TTCAGGAGGCTGGGGCAGAGAGG - Intronic
1148113426 17:45161032-45161054 TTCCAGAGGCTGGCGCCGCGGGG - Intronic
1150104074 17:62448832-62448854 CTCAGGAGGCTGAGGCGGGGAGG + Exonic
1150133317 17:62680722-62680744 CCCCGGAGGCGGGCGCGGCAGGG - Intronic
1151727421 17:75892961-75892983 CTCTGGAGGCTGGCCTGGGGTGG - Intronic
1153051715 18:907316-907338 CTCGGGAGCCAGGCGGGGAGGGG + Intronic
1153952518 18:10069192-10069214 CTCCGGAGGCTCGCTGTGAGAGG - Intergenic
1154279757 18:12991778-12991800 CTCCAGAGGGTAGCACGGAGAGG - Intronic
1158396825 18:57085620-57085642 CTTGGGGGGCTGGCGAGGAGGGG + Intergenic
1158652293 18:59299009-59299031 CTCCGGAGGCTGGCGCGGAGTGG - Intronic
1160497534 18:79384021-79384043 CACAGGAGGCTGGGGCAGAGGGG - Intergenic
1160772500 19:839267-839289 CTCAGGGGGCTGGGGCAGAGGGG + Intergenic
1160953442 19:1678802-1678824 CTCCTGAGGCGGGTGGGGAGGGG - Intergenic
1161589819 19:5124283-5124305 CTCCCCAGGCCGGCGCGGTGGGG + Intronic
1161809620 19:6464485-6464507 CTCTGGCGGCTGGGGCGGGGCGG + Intronic
1161932069 19:7347636-7347658 CTCCGGAGGCTGAGGCGGGGAGG - Intergenic
1162129011 19:8513986-8514008 CTGCGGGGACTGGCGGGGAGCGG - Intronic
1162445611 19:10720619-10720641 CTCAGGAGGCTGGCCCTGGGAGG + Intronic
1162498216 19:11035244-11035266 CTGCGGAGCCTGGCCAGGAGTGG - Intronic
1162533194 19:11247605-11247627 CCCCGGGGGCTGGTGTGGAGGGG + Intronic
1162647635 19:12061499-12061521 CTCGGGAGGCTGGGGCAGTGAGG + Intergenic
1162954313 19:14090016-14090038 CGCCGGAGGGGGGCGCGGTGCGG - Exonic
1163004207 19:14387341-14387363 CTCGGGAGGCTGAGGCGGGGAGG + Intronic
1164275731 19:23716237-23716259 TTCCTGAGGCTGGAGTGGAGTGG + Intergenic
1164527036 19:29020231-29020253 CTCAGGAGGCTGACGGTGAGGGG - Intergenic
1164723023 19:30445710-30445732 CTGAGGAGGATGGCGAGGAGGGG - Exonic
1164971972 19:32540269-32540291 CTCTGGAGGCTGGAGTGCAGTGG - Intergenic
1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG + Exonic
1166533838 19:43559373-43559395 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1167315250 19:48759014-48759036 CTCCGGAGGCTGAGGCAGAATGG + Intergenic
925355036 2:3234722-3234744 CTGCAGAGGCTTCCGCGGAGTGG - Intronic
925376124 2:3387676-3387698 CTCCGGAGGCGCGAGCTGAGGGG - Exonic
926227314 2:10977290-10977312 CCCCGGAGGCTGGCGTGGGATGG + Intergenic
926522396 2:13931384-13931406 CTCCGGAGGCTGAGGCAGAATGG + Intergenic
927930049 2:27038182-27038204 CTCCAGACGCTGGCACTGAGGGG - Exonic
931309591 2:61065859-61065881 CTGCGGAGACTAGCGCCGAGGGG - Intronic
932277224 2:70460673-70460695 CTCTGGGGGCTGGTGGGGAGAGG + Intronic
934588317 2:95525588-95525610 CTGCGGACGCTGGTGCGGCGAGG + Intergenic
934716788 2:96549325-96549347 CCCCCGAGGCAGGCGGGGAGCGG + Exonic
938044537 2:128105843-128105865 CTCTGGAGGCTGGAGTGCAGTGG + Intronic
938909877 2:135876219-135876241 CTCCGGAGGCGGGCGAGGCCCGG + Intronic
939050992 2:137307847-137307869 CTCCGGAAGCTGACCAGGAGCGG + Intronic
939491495 2:142882485-142882507 CACCGGAGCCTGTCGTGGAGTGG - Intronic
940774976 2:157875978-157876000 CTGCGGTGGCTGCAGCGGAGCGG + Intergenic
944670351 2:201989300-201989322 GTCCAGAGGCTGGAGCAGAGTGG + Intergenic
945119371 2:206442911-206442933 CGCCGCAGGCTGGCGCGGAGTGG - Intergenic
946356570 2:219189766-219189788 CTCGGGAGGCTGGGGCAAAGGGG - Intergenic
946952969 2:224897547-224897569 TACCGGAGGCTGGGGTGGAGGGG - Intronic
947922826 2:233893181-233893203 CTGCGGAAGCTGGAGAGGAGGGG - Intergenic
948696813 2:239736924-239736946 TTCCGGAGGCCGGAGGGGAGAGG - Intergenic
948720701 2:239898368-239898390 CTCTGGAGGCTGGCAGGCAGGGG - Intronic
948894687 2:240922624-240922646 GTCTGGAGGCTGCCGAGGAGAGG + Exonic
1172406803 20:34695811-34695833 CTCCGGAGGCTGAGGCAGAATGG + Intergenic
1172742213 20:37178196-37178218 CTCCGGAGGCTGAGGCGGGAGGG + Intronic
1173279017 20:41610651-41610673 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1174249967 20:49211802-49211824 CTCAGGAGGCTGAGGCAGAGTGG - Intergenic
1174420873 20:50398574-50398596 CAACAGAGGCTGGAGCGGAGGGG + Intergenic
1176023353 20:62973608-62973630 CTGGGGAGGCTGGCGTGGGGCGG - Intergenic
1176126136 20:63475695-63475717 CCCTGGAGCCTGGCGCAGAGAGG + Intergenic
1177456840 21:21351007-21351029 CTCCGGAGGCTGAAGCAGAATGG + Intronic
1177652775 21:23979612-23979634 CTCCGGAGGCTGAGGCAGAAAGG - Intergenic
1177792156 21:25733420-25733442 CTCCGGAGGCTGAGGCAGAAGGG + Intronic
1178337323 21:31755032-31755054 CTCCGGAGGCTGAGGCGGAAAGG - Intergenic
1179218498 21:39386956-39386978 CTCAGGAGGCTGAGGCGGGGAGG - Intronic
1179573964 21:42295213-42295235 CTCCGGAGGCTGAGGCGGGAGGG + Intronic
1180047570 21:45316826-45316848 CTCCGGAGGCGGGGGAGGTGGGG + Intergenic
1181458907 22:23074752-23074774 CTCGGGAGGCTGGAGAAGAGCGG + Intronic
1182300315 22:29333422-29333444 CTCAGAAGGCTGGTGGGGAGTGG - Intronic
1183280448 22:36929393-36929415 CTCAGGAGGCTGGACTGGAGGGG - Exonic
1183423652 22:37726083-37726105 CTCAGGAGCCTGGCGTGGTGGGG - Exonic
1183587735 22:38762684-38762706 TTGTGGAGGCTGGAGCGGAGAGG - Intronic
1185190318 22:49432381-49432403 CTCCGAAGGGTGGAGCCGAGGGG - Intronic
954404557 3:50338096-50338118 CTGCGGAGCCTGGCGAGCAGCGG - Intronic
954519662 3:51213382-51213404 CTCAGGAGGGTGGTGTGGAGGGG + Intronic
959920990 3:111868125-111868147 CTCAGGAGGCAGAGGCGGAGAGG - Intronic
960251358 3:115458810-115458832 CTCAGGAGGCTGAAGCCGAGAGG + Intergenic
961487917 3:127230080-127230102 CCCCGGGGGCTGGAGCAGAGAGG + Intergenic
963236868 3:142964104-142964126 CTCCGGAGGTCGCCGGGGAGGGG + Intergenic
966696432 3:182793987-182794009 CCGCCGAGGCTGGCGCCGAGCGG + Intronic
968093014 3:195909693-195909715 CTGCGGGGGCCGGCGCGGGGCGG - Intronic
969225707 4:5797071-5797093 CTCCGGAGGCTGGCACTCCGCGG + Exonic
970442957 4:16099895-16099917 CTCCGGAGGCTGAGGCAGAATGG - Intergenic
970824461 4:20254407-20254429 TGTCGCAGGCTGGCGCGGAGGGG + Intronic
972883439 4:43454950-43454972 TTCCAGAGGCTGGCAGGGAGAGG - Intergenic
975560861 4:75707082-75707104 CTCGGGAGGCTGGGGCAGGGAGG + Intronic
976609269 4:87013146-87013168 CTCCGGAGGCTGAGGCAGAATGG - Intronic
976966133 4:91043628-91043650 CTCTGGAGGCTGGAGTGCAGTGG + Intronic
976980209 4:91217870-91217892 CTCCTGAGTCTGGTGGGGAGTGG - Intronic
979338538 4:119492086-119492108 CTCCGGAGGCTGAGGCAGAAGGG - Intergenic
981660291 4:147158400-147158422 GTCCTGAGGCAGGCGCCGAGCGG + Intergenic
985693290 5:1325418-1325440 CTCCCGAGGCTGGTGCTGACTGG - Intronic
986059290 5:4172845-4172867 CTCCGGTGGCTGAAGCGGACAGG - Intergenic
986721701 5:10564768-10564790 CTGCGGACGCTGGTGCGGCGCGG + Exonic
989379361 5:40798228-40798250 CGCCGGGGGCGGGCGGGGAGGGG + Exonic
989581608 5:43038651-43038673 CTCCGGAGGCTGGGGTGGGCGGG - Intergenic
991300909 5:65128422-65128444 CTCCACAGGCTGGCCCAGAGCGG - Intergenic
992431410 5:76715107-76715129 ATCCGGAGGCTGGGGCGAAAGGG + Intergenic
992457702 5:76931212-76931234 CTCGGGAGGCTGAGGCGGAAGGG - Intergenic
993343170 5:86750425-86750447 CTCGGGAGGCTGGGGCAGAATGG - Intergenic
997264861 5:132489696-132489718 CTCCAGAGACTGGCTGGGAGGGG - Intronic
997865064 5:137454503-137454525 CTGCTGAGGCTGGAGGGGAGGGG + Intronic
998144509 5:139719256-139719278 CTCGGGAGGCTGACGCAGAATGG - Intergenic
998216412 5:140241290-140241312 CTCTGGAGGCTGGGGAGAAGGGG + Intronic
999271996 5:150302230-150302252 GTGGGGAGGCTGGGGCGGAGCGG + Exonic
1001296828 5:170504339-170504361 TTCCGAAGGCTCGCGGGGAGCGG + Intronic
1002541164 5:179907523-179907545 CCCGGGAGCCGGGCGCGGAGGGG - Intronic
1002715500 5:181224223-181224245 CTGTGGGGGCTGGCGCGGGGTGG + Exonic
1003218558 6:4136191-4136213 CCGCGGAGCCTGGCGAGGAGGGG + Intergenic
1003560145 6:7173271-7173293 CTCAGGAGGCTGGGGCGGTTTGG + Intronic
1004008122 6:11655647-11655669 CTCGGGAGGCTGAGGCAGAGTGG - Intergenic
1005285589 6:24323168-24323190 CTCTGGAGGCTGGAGTGCAGTGG - Intronic
1005904189 6:30246710-30246732 CTTGGGAGGCTGAGGCGGAGAGG - Intergenic
1006234790 6:32619658-32619680 CTCTGGAGGCTGGAGCATAGTGG - Intergenic
1006300962 6:33193315-33193337 CGCCGCCCGCTGGCGCGGAGAGG + Intergenic
1006951011 6:37820452-37820474 CTCCGGAGGACGGGGAGGAGGGG - Intronic
1006990727 6:38212632-38212654 CTCTGGAGGCTGGTGAGGGGAGG + Intronic
1007691631 6:43705794-43705816 CTCAGGAGGCTGGGGCGGAAGGG - Intergenic
1007792703 6:44321320-44321342 CTCAGGAGGCTGAGGCGGGGAGG + Intronic
1011247132 6:85331401-85331423 CTCCGGAGGCTGAGGCAGAATGG - Intergenic
1011434479 6:87322496-87322518 TTCCGGAGGCTGCGGCGCAGCGG - Intronic
1013619314 6:111873006-111873028 CGCCGGAGGAGGGCGGGGAGAGG - Exonic
1013619453 6:111873463-111873485 CTCCGGAGGGGAGCGAGGAGGGG + Intergenic
1015181625 6:130366621-130366643 CTCTGGAGGCTGTAGCGGAGGGG - Intronic
1016982292 6:149864279-149864301 CGCCGCAGGCCGGGGCGGAGAGG - Intergenic
1017132455 6:151119414-151119436 CTCAGGAGGCTGAGGCGGAAGGG - Intergenic
1017662452 6:156687527-156687549 GGCCGGAGCCGGGCGCGGAGCGG + Intergenic
1017810676 6:157981660-157981682 CCCCGCAGGCGGGCGTGGAGCGG - Intergenic
1021450213 7:20777833-20777855 CACCGGAGGCTGCTGCGGCGTGG - Intergenic
1022400208 7:30028906-30028928 TTCCTGAGGCCAGCGCGGAGCGG + Intronic
1023313846 7:38915161-38915183 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1032298772 7:130668325-130668347 CGCCGGAGGCCCGCGCGCAGGGG + Intronic
1033357028 7:140608244-140608266 CTTCAGAGGCTGGCACTGAGGGG + Intronic
1034418617 7:150977897-150977919 CTCAGGATGCCGGTGCGGAGGGG - Exonic
1034560253 7:151875819-151875841 CCCGGGCGGCTGGCGCGGACGGG + Intronic
1035373835 7:158395163-158395185 CTCCGGAGTCTGGGGTGGAGGGG + Intronic
1035534052 8:377750-377772 CTGCGGAGGCTGGTGCTCAGTGG - Intergenic
1036213942 8:6863661-6863683 CAAGGGAGGCTGGCGGGGAGGGG + Intergenic
1036739517 8:11347901-11347923 CTCCGGAGCCCGGCGCGGGGAGG + Intergenic
1036931846 8:12963638-12963660 CTCGGGAGGCTTGAGCAGAGAGG + Intronic
1039062319 8:33581573-33581595 CTCCGGAGGCCAGAGAGGAGGGG + Intergenic
1039887710 8:41664741-41664763 CGCCGGAGGCCGGGGCTGAGGGG - Intronic
1041304469 8:56446023-56446045 CTGCTGAGGCTGTCGCGGCGAGG - Exonic
1042965799 8:74350595-74350617 CGGCGGAGGGTGGCGCGGATCGG + Intronic
1043296214 8:78666292-78666314 CTCCGGAGGCTGGGGCCGAAGGG + Intronic
1045021224 8:98045887-98045909 CGCCGGAGGCTGAGGCGGAGAGG + Intronic
1046456059 8:114463436-114463458 CTCAGGAGGCTGGAGTGCAGTGG + Intergenic
1049194782 8:141308923-141308945 CTTCGGAGGGTGGCAGGGAGGGG - Intergenic
1049274947 8:141715575-141715597 GTCTGGAAGCTGGGGCGGAGGGG + Intergenic
1049621297 8:143599477-143599499 CTCCGGAGGAGGTTGCGGAGTGG + Exonic
1049651474 8:143771751-143771773 CTCGGGGCGGTGGCGCGGAGTGG + Intergenic
1049761468 8:144333766-144333788 CGCCGGAGGCGGGGGCGGGGCGG - Exonic
1050176228 9:2872024-2872046 GACTGGAGGCTGGCGGGGAGGGG + Intergenic
1050231174 9:3526756-3526778 CGCCGCAGCGTGGCGCGGAGAGG + Intergenic
1051414867 9:16828946-16828968 CTCCAGAGGCTGGGGCGCGGGGG + Intronic
1052756933 9:32551143-32551165 CTCCGGGGTCTGGAGCGGCGGGG - Intronic
1056495705 9:87153099-87153121 CTCTGGAGGCTGGGGCAGAAGGG - Intronic
1061128381 9:128690257-128690279 CTCCGCACGCTGGCGCGACGGGG - Intronic
1061713764 9:132505714-132505736 CTCCTGGGGCTGGGGCTGAGGGG + Intronic
1062306101 9:135907775-135907797 CTGCGGAAGCGGGCGGGGAGGGG - Intergenic
1185678004 X:1864469-1864491 CTCAGGAGGCTGAGGTGGAGGGG - Intergenic
1187314151 X:18176569-18176591 CTCAGGAGGCTGGGGAGGAAGGG + Intronic
1190861011 X:54344333-54344355 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1190866982 X:54392899-54392921 CTCCGGAGGCTGAGGCAGAATGG + Intergenic
1193152254 X:78138258-78138280 TTCGGGAGGCTGTCGCGGGGAGG - Intronic
1194728264 X:97424720-97424742 CTCAGGAGGCTGGGGCGGGAGGG - Intronic
1196922906 X:120602904-120602926 CTCCGGAGGCTGAGGCGGGAGGG + Intronic
1198712350 X:139519023-139519045 CTCAGGAGGCTGAGGCAGAGTGG + Intergenic
1199771183 X:150976242-150976264 CTCCGGGGTCTGGTGGGGAGGGG + Intergenic
1200117920 X:153777217-153777239 CGCTGGAGGATGGCGAGGAGGGG + Exonic