ID: 1158652924

View in Genome Browser
Species Human (GRCh38)
Location 18:59303782-59303804
Sequence CTACATGTCTACAGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158652924_1158652933 26 Left 1158652924 18:59303782-59303804 CCATGCTCCCTGTAGACATGTAG 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1158652933 18:59303831-59303853 AGGAGGAGCAAACCGAACTGGGG 0: 1
1: 0
2: 1
3: 11
4: 143
1158652924_1158652927 -5 Left 1158652924 18:59303782-59303804 CCATGCTCCCTGTAGACATGTAG 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1158652927 18:59303800-59303822 TGTAGTCCATTGCTCTTTCAAGG 0: 1
1: 0
2: 0
3: 8
4: 130
1158652924_1158652932 25 Left 1158652924 18:59303782-59303804 CCATGCTCCCTGTAGACATGTAG 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1158652932 18:59303830-59303852 TAGGAGGAGCAAACCGAACTGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1158652924_1158652934 30 Left 1158652924 18:59303782-59303804 CCATGCTCCCTGTAGACATGTAG 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1158652934 18:59303835-59303857 GGAGCAAACCGAACTGGGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 137
1158652924_1158652930 9 Left 1158652924 18:59303782-59303804 CCATGCTCCCTGTAGACATGTAG 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1158652930 18:59303814-59303836 CTTTCAAGGACATGAGTAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 136
1158652924_1158652929 6 Left 1158652924 18:59303782-59303804 CCATGCTCCCTGTAGACATGTAG 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1158652929 18:59303811-59303833 GCTCTTTCAAGGACATGAGTAGG 0: 1
1: 0
2: 1
3: 9
4: 122
1158652924_1158652931 24 Left 1158652924 18:59303782-59303804 CCATGCTCCCTGTAGACATGTAG 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1158652931 18:59303829-59303851 GTAGGAGGAGCAAACCGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158652924 Original CRISPR CTACATGTCTACAGGGAGCA TGG (reversed) Intronic
900096958 1:943692-943714 TTCCAGGTCTTCAGGGAGCAGGG + Exonic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
915339790 1:155170592-155170614 CAACCTGTGTCCAGGGAGCAAGG - Intronic
916553795 1:165875559-165875581 TTGCATGTCTGCAGGGGGCAGGG - Intronic
919695734 1:200573305-200573327 GTACATGACTACACTGAGCATGG + Intronic
920049263 1:203153541-203153563 CTGCAGGGCTACAGGGAGGAGGG - Intronic
920839727 1:209544552-209544574 GGACATTTCTACAGGTAGCAGGG - Intergenic
921525223 1:216209270-216209292 CTACATGGACACAGGGAGCGGGG + Intronic
922486932 1:225980693-225980715 CTATTTGCCTGCAGGGAGCAGGG + Intergenic
1064504252 10:16012038-16012060 TTAAATGTCTCCAGTGAGCATGG - Intergenic
1068313182 10:55305869-55305891 GTTCATGTCTACAAGGAGGAAGG - Intronic
1068733240 10:60383668-60383690 CTCCAGGTCTCCAGGGAGCATGG - Intronic
1072321342 10:94253211-94253233 CTGCAGGTGTACAGGAAGCATGG + Intronic
1073439267 10:103543152-103543174 CTGCAGGACTACAGGGAGGAGGG - Intronic
1076847078 10:133074592-133074614 GTAGGTGTCTACAGGGACCACGG - Intronic
1077789639 11:5424515-5424537 CTACCTGTGTACTGGGAGGATGG - Intronic
1080790612 11:35519529-35519551 TCTCATGTCTACTGGGAGCAAGG + Intronic
1081291640 11:41333572-41333594 CTACATATTTAAAGGGAGGAGGG - Intronic
1081565216 11:44256558-44256580 CTACATGTGTACACAGAGGAAGG + Intergenic
1082205001 11:49422489-49422511 CAATATGTCTATAGGGATCAAGG + Intergenic
1082302287 11:50522611-50522633 CTATATGTCTACAGGCAGAATGG - Intergenic
1084548890 11:69828964-69828986 CTACCTGTCTCCAGGGTGCTGGG + Intergenic
1085311782 11:75521120-75521142 GTCCATGTCTATGGGGAGCAGGG - Intronic
1086650093 11:89278053-89278075 CAATATGTCTATAGGGATCAAGG - Intronic
1089704598 11:120268840-120268862 CTACATCCCTCCAGGGACCAAGG - Intronic
1102804494 12:115767713-115767735 CTGAAAGTCTATAGGGAGCAGGG - Intergenic
1103700489 12:122846645-122846667 CTCCCCGACTACAGGGAGCAGGG + Intronic
1103768102 12:123297526-123297548 CTACAGGTGTCCAGGAAGCAGGG - Intronic
1105786905 13:23759260-23759282 CTACATCTCTCCAGCCAGCATGG + Intronic
1107324938 13:39231582-39231604 GTACATGTTTACATGTAGCAAGG - Intergenic
1108245083 13:48506015-48506037 CTACAAGTCTCCAGTGAGTAAGG + Intronic
1108482952 13:50893773-50893795 TTGCATGTAAACAGGGAGCATGG - Intergenic
1110240614 13:73262405-73262427 CCACATGTGTTCAGGAAGCATGG + Intergenic
1112041829 13:95554459-95554481 CTACATGTCTGCAGTGAGAGTGG + Intronic
1114666540 14:24380621-24380643 CTACATGTCTGTAGAGAGCCTGG - Intergenic
1114812879 14:25921202-25921224 GTCCATTTCTACAGGTAGCAAGG - Intergenic
1115792891 14:36899490-36899512 CTTCTTGCCTACAGGGAGAATGG + Intronic
1117639291 14:57780503-57780525 GTAAATTTCTTCAGGGAGCATGG - Intronic
1119686028 14:76632051-76632073 CTACATTCCAACACGGAGCAGGG + Intergenic
1121470867 14:94153319-94153341 CTACAGGTCTACATGGAACCCGG - Intronic
1126198706 15:45960692-45960714 CTACATGAGTGCAGGGACCAGGG + Intergenic
1126490756 15:49233147-49233169 CTACAGGTGTACAGGAAGCATGG + Intronic
1128683560 15:69668000-69668022 CTGCATGTCAACATGGAGCCAGG - Intergenic
1129683171 15:77669706-77669728 CTAGATGCCTACAGGGGCCAGGG + Intronic
1133699942 16:8299529-8299551 AGCCATGTCTACAGGGAGGAAGG - Intergenic
1136146087 16:28317480-28317502 CTGCATGTCTTCAGTGAGAAGGG - Exonic
1138063401 16:53914965-53914987 AGCCATGTCTACAGGGAGAATGG + Intronic
1139235491 16:65334145-65334167 CAACAAGTCTACAGGCTGCAAGG + Intergenic
1140085186 16:71789275-71789297 CTACCTGTCCAAAGTGAGCAGGG + Exonic
1141196032 16:81861999-81862021 CCACATGTTGACAGAGAGCAGGG - Intronic
1141943716 16:87295966-87295988 CTACAAGTTTACAGGAAACACGG + Intronic
1142122288 16:88392870-88392892 CCACAGATCTACAAGGAGCAAGG - Intergenic
1145935674 17:28713316-28713338 TTAGATGTCAACAGGGAGCCAGG + Intergenic
1152119339 17:78408636-78408658 CAACAGAACTACAGGGAGCAAGG - Intronic
1154253550 18:12764396-12764418 CCACATCTGTACAGGAAGCATGG - Intergenic
1155326074 18:24666083-24666105 CTGCATAACTCCAGGGAGCATGG + Intergenic
1155349657 18:24894118-24894140 CTGCCTTTCTGCAGGGAGCATGG - Intergenic
1155694240 18:28665501-28665523 GTACATGTCTACAGGGCTCTTGG + Intergenic
1156770668 18:40718863-40718885 ATACTTGTCTACTGGGAACAGGG - Intergenic
1158652924 18:59303782-59303804 CTACATGTCTACAGGGAGCATGG - Intronic
1163787261 19:19281217-19281239 ATCCATGTCCTCAGGGAGCATGG - Intronic
1167515197 19:49919268-49919290 CAGCCTGTCTCCAGGGAGCAGGG - Intronic
927468251 2:23352608-23352630 CTATCTGTCTTCAGAGAGCAAGG + Intergenic
928147592 2:28793546-28793568 CATCATGACTACAGGGAGCTGGG - Intronic
928950040 2:36806315-36806337 CTATGTGTCTACAGCCAGCAGGG + Intronic
930892866 2:56411491-56411513 ATAAATGCCTAGAGGGAGCAGGG + Intergenic
931763262 2:65434468-65434490 CTCCATGTCTACAGAGATCATGG - Intergenic
932666456 2:73702351-73702373 GTATATGTGTACAGGGACCAAGG - Intergenic
940168769 2:150803932-150803954 CTACCTGACTGCAGGGAGTAAGG - Intergenic
940449978 2:153824934-153824956 ATACATTTCTACAGGGTGTACGG - Intergenic
941858474 2:170254206-170254228 CTAAATGTCTATAGGGATCATGG - Intronic
943030257 2:182677631-182677653 CTACAGGGCTACAGACAGCATGG + Intergenic
943079656 2:183242966-183242988 CTGAATGACTAAAGGGAGCACGG + Intergenic
944593037 2:201236196-201236218 CTAAATGCCTAAAAGGAGCAGGG - Intronic
944630777 2:201621902-201621924 ATGCATGTCTCCAGGAAGCAGGG - Exonic
946054300 2:216887460-216887482 GTAGGTGTCCACAGGGAGCAGGG - Intergenic
947678260 2:232005335-232005357 CTACATGTCTACATGGCTAAGGG + Intronic
1171170630 20:23012239-23012261 CCAAATGTCTACAGGGGTCAGGG - Intergenic
1172933917 20:38605566-38605588 ATATATTTCTACAGGGAGCAAGG - Intronic
1173789618 20:45819447-45819469 CTACATGTTTACGGGCAACATGG - Intergenic
1175697066 20:61110674-61110696 CTAAATGTCTGCAGAGACCAAGG + Intergenic
1179277114 21:39902140-39902162 CTACATGTCTTGAAGGAGCAAGG + Intronic
1181468898 22:23126175-23126197 ATACATGGCTAAAGGGAGAAAGG + Intronic
1182087875 22:27573863-27573885 CTCCATGACTGCTGGGAGCAGGG + Intergenic
1184324738 22:43774622-43774644 TTAGGTGTCTGCAGGGAGCACGG + Intronic
949102522 3:163146-163168 TTAGATGTCTATAGGGACCAGGG + Intergenic
951178497 3:19630703-19630725 CCAAATGTCTCCGGGGAGCAGGG + Intergenic
952581027 3:34833651-34833673 CTACATGTTAAAAGAGAGCAGGG + Intergenic
954134857 3:48577425-48577447 ATACATGTCTCCAAAGAGCATGG + Intronic
955346089 3:58163027-58163049 CAACAGTTCTACAGGGAGCCTGG - Intronic
959857282 3:111174603-111174625 TTACATGTCTACAGTGTGCTGGG + Intronic
963045807 3:141101858-141101880 CTACAAGTCTCCAGTGAGCAAGG - Intronic
963515604 3:146304678-146304700 CTATATGGCAACAGGGAACAAGG + Intergenic
967081356 3:186052677-186052699 CTGCAAGTCTGCTGGGAGCATGG - Intronic
967916947 3:194585747-194585769 GTACATGTGTGCAGGAAGCATGG + Intergenic
974387193 4:61217076-61217098 CTAGATGTCTGCAGGGTGCAGGG + Intronic
976821196 4:89208993-89209015 ATACATGTATACAAGAAGCATGG + Intergenic
979198102 4:117943954-117943976 CTGCAGGTGTACAGGAAGCATGG + Intergenic
981603806 4:146521809-146521831 CTGCATGTCTGGAGGGACCAAGG - Exonic
986165893 5:5271222-5271244 CTAAATCTCTGCAGGGGGCAGGG + Intronic
989171905 5:38479642-38479664 ATACATTTCAACAGGGAACAAGG + Exonic
990208515 5:53455781-53455803 CTACATAACTACAAAGAGCAGGG + Intergenic
991478809 5:67054323-67054345 GTCCATGTCTACCGGGAACATGG + Intronic
994169911 5:96647730-96647752 CTACAAGCCTGCAGGGAGCTAGG + Intronic
994234014 5:97340301-97340323 CTACAGGTCTGCAAGAAGCATGG + Intergenic
997021455 5:130007599-130007621 CTAAATGTCCACAGGGGTCATGG - Intronic
998233949 5:140381584-140381606 CTACAGGACTACAGGGACCGAGG + Intergenic
999182465 5:149679790-149679812 CTACATGTTAACAGGCGGCAGGG - Intergenic
1000357835 5:160417991-160418013 CCCAGTGTCTACAGGGAGCACGG - Intronic
1004037275 6:11935643-11935665 CAGCATGTCAACAGGCAGCAGGG - Intergenic
1005134998 6:22557765-22557787 CTACATGGCTACCTGGAGAAAGG + Intergenic
1012436234 6:99217932-99217954 TCAGATGTCTGCAGGGAGCAAGG + Intergenic
1013707442 6:112854814-112854836 CTCCATTTCTCAAGGGAGCAGGG + Intergenic
1015210783 6:130695900-130695922 CTATCTGTCTGCAGGGAGAAAGG - Intergenic
1017530756 6:155289992-155290014 CTGCAACTCTACAGGAAGCATGG - Intronic
1017533820 6:155325995-155326017 CTGCTTGTATACAGGGAGAAAGG + Intergenic
1017656433 6:156633914-156633936 CTGCATGTCTGCAGGTTGCATGG + Intergenic
1018697747 6:166403852-166403874 CTAGATGCCTCCAGGGAACATGG - Intergenic
1026069598 7:67106295-67106317 TCACATGTCTACAGGGACCAAGG - Intronic
1027137307 7:75633958-75633980 CTATAGGGCTATAGGGAGCAGGG + Intronic
1028893479 7:96014347-96014369 TTACATGTCTGCTGGGAGAAGGG - Intronic
1029852670 7:103481067-103481089 CAGCATGTTGACAGGGAGCAAGG + Intronic
1029928834 7:104348863-104348885 ATAAATGTCTAAATGGAGCAGGG - Intronic
1032497784 7:132375772-132375794 CTACATGTGTTCAGTCAGCAGGG + Intronic
1032782926 7:135178552-135178574 CGACATTTCTACAGGCAACAGGG - Intergenic
1033781462 7:144675288-144675310 CTAGAAGTCTACAGGGGACACGG + Intronic
1034528245 7:151679518-151679540 GCACATGCCTACAGGAAGCAGGG - Intronic
1035081371 7:156219267-156219289 GTCCAAGTCTGCAGGGAGCACGG + Intergenic
1035924793 8:3715924-3715946 CATCATGTCCACAGGGAGTAGGG - Intronic
1038896182 8:31784988-31785010 CTAAATCTTTACAGAGAGCAGGG + Intronic
1038993595 8:32896718-32896740 CAATATATCTGCAGGGAGCAAGG + Intergenic
1039700017 8:39952615-39952637 CTACGTGTGTAGAGGGGGCATGG + Intronic
1042802355 8:72733630-72733652 GAACATGTCTACAGGGTGCCGGG - Intronic
1045866210 8:106868493-106868515 CTGCATGTGTGCAGGGAGAAGGG - Intergenic
1046710718 8:117508407-117508429 CTATATGTCTACAAGGACTAAGG - Intergenic
1047774917 8:128062068-128062090 CTACATCTCAATAGGGAGCCTGG + Intergenic
1049295389 8:141831136-141831158 ATACATGTATACAGAAAGCATGG - Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1050328179 9:4517852-4517874 GTACAAGGCTACAGGGATCAGGG - Intronic
1050572264 9:6952885-6952907 CAACATTTGTACAGTGAGCACGG + Intronic
1054843511 9:69768560-69768582 ATACATGTATCCAGGGACCAAGG - Intergenic
1056541271 9:87573379-87573401 CACCATCTCTCCAGGGAGCAGGG - Intronic
1057325551 9:94060576-94060598 CTGCAGGTGTACAGGAAGCATGG + Intronic
1061851620 9:133419255-133419277 ATAAATGTCTGCGGGGAGCAGGG + Intronic
1061882961 9:133577201-133577223 CTACATATCTACAGAGAGGATGG + Intergenic
1185870429 X:3660253-3660275 CTAAATTTCTTCAGGGCGCAAGG + Intronic
1188486400 X:30686974-30686996 CAACGTGTCTAGAGGGAACAGGG - Intronic
1190136768 X:47805503-47805525 CTACATGCCTTCAGGCAACACGG + Intergenic
1192263257 X:69521832-69521854 ATTCCTGTCTTCAGGGAGCAGGG - Intronic
1192559537 X:72116984-72117006 CTACATATCTATAGGTACCAGGG + Intergenic
1200061318 X:153485036-153485058 CTGCATGGCCACAGGGACCAGGG + Intronic
1200894600 Y:8361472-8361494 CACCCTGTCTACAGGGAACATGG - Intergenic