ID: 1158653643

View in Genome Browser
Species Human (GRCh38)
Location 18:59308984-59309006
Sequence TAGCCACAGCTGGTGATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158653643 Original CRISPR TAGCCACAGCTGGTGATAAC TGG Intronic
904958893 1:34315052-34315074 TAGACACAGCTGGTAATATTAGG - Intergenic
911704706 1:100997889-100997911 TACCCACAGCTGGCCTTAACTGG + Intronic
911813347 1:102312071-102312093 CAGCCACTGCTGCTGATACCAGG - Intergenic
912894777 1:113575501-113575523 CAGCCTCTGCTGGTGATACCAGG - Intronic
913227576 1:116713556-116713578 GAGCCACAGCTGCTGACAACAGG + Intergenic
914343184 1:146777113-146777135 TGTCCACAGCTGGTGATACAGGG + Intergenic
914369217 1:147007345-147007367 CAGCCTCTGCTGGTGATAGCTGG + Intergenic
919461562 1:197883836-197883858 TAGCTTCCGCTGGTGATATCCGG - Intergenic
919927999 1:202202519-202202541 TAGCCATAGCTGGTTAGAGCTGG - Intronic
922810895 1:228414975-228414997 TGGCCACAGGTGGTCATCACAGG + Exonic
922900759 1:229134810-229134832 TAGCCACAGCTGGAGCTGACTGG - Intergenic
923685062 1:236147982-236148004 GAGCCACAGCTGGAAACAACAGG - Intronic
923932814 1:238721996-238722018 TAGCCATAGCTGGAGATACTTGG - Intergenic
1064157859 10:12918586-12918608 TATGCACAGATGTTGATAACAGG + Intronic
1065627390 10:27645654-27645676 TAACCACAGCTGACAATAACTGG - Intergenic
1066285907 10:33965939-33965961 TAGAGACAGGTGGTGAAAACAGG - Intergenic
1066315120 10:34238228-34238250 TAATCAAAGCTGATGATAACTGG + Intronic
1071112119 10:82171890-82171912 TAGCCACACCTGGTTGTAAGAGG + Intronic
1071844410 10:89506403-89506425 CAGCCTCCGCTGGTGATACCTGG + Intronic
1078665545 11:13322012-13322034 CAGCCTCACATGGTGATAACAGG - Intronic
1078895018 11:15590251-15590273 TAGCAACAGATGGTGACTACAGG - Intergenic
1079544481 11:21616075-21616097 TAGGCACAGCTGGGGAAAGCTGG + Intergenic
1081080898 11:38738116-38738138 TGGCCACAGCTTGTGATTAAAGG - Intergenic
1081158138 11:39720329-39720351 TAGCCTCAGATGTTGATAACTGG + Intergenic
1081198894 11:40193283-40193305 CAGCCTCTGCTGGTGATACCAGG + Intronic
1086078579 11:82879818-82879840 CAGCCTCCGCTGGTGATACCAGG - Intronic
1087484412 11:98743937-98743959 TAAGCACAGCTGGTGATTGCTGG - Intergenic
1088152077 11:106757662-106757684 CAGCCTCCGCTGGTGATACCCGG - Intronic
1091071301 11:132566120-132566142 TAGGCACTGCAGGTGATATCTGG + Intronic
1091655213 12:2341135-2341157 AAGCCACCGCAGGTGAAAACAGG - Intronic
1092232567 12:6784414-6784436 TAACCACAGCTGGTGGAACCGGG - Intergenic
1093320178 12:17704665-17704687 CAGCCACTGCTGCTGATACCAGG - Intergenic
1093414871 12:18908379-18908401 AAGCCACAGCTGGAGCTAAAGGG - Intergenic
1093781929 12:23146689-23146711 CAGCCACCGCTGCTGATACCGGG + Intergenic
1095802656 12:46284322-46284344 CAGCCTCTGCTGGTGATACCTGG + Intergenic
1096203038 12:49699415-49699437 CTGCTACAGCTGGTGAGAACAGG - Intronic
1103972825 12:124682638-124682660 TGGCCACAGCTGGGGAGCACAGG - Intergenic
1104237173 12:126950418-126950440 TGCCCACAGCTGGTGTTCACAGG + Intergenic
1107171388 13:37346256-37346278 TACCCAGAGCTTGTGAGAACAGG + Intergenic
1108188151 13:47908791-47908813 CAGCCTCTGCTGGTGATACCCGG + Intergenic
1114301404 14:21382196-21382218 TAGCCACAGGTTTTGTTAACTGG + Intronic
1115135080 14:30098244-30098266 GAGCCTCCGCTGGTGATACCAGG + Intronic
1115511368 14:34140470-34140492 CAGCCTCTGCTGGTGATACCCGG + Intronic
1117380833 14:55161176-55161198 GAGAGACACCTGGTGATAACAGG + Intronic
1119445992 14:74663804-74663826 GAGGCACAGCTGGTTAAAACTGG + Exonic
1124084293 15:26532184-26532206 CAGCCTCTGCTGGTGATAGCAGG + Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1131057346 15:89383539-89383561 TGGGCACAGCTGTAGATAACAGG + Intergenic
1131864603 15:96694191-96694213 GAACCACATCTGGTGACAACTGG + Intergenic
1132371577 15:101303083-101303105 TAGCCACAGCTGATGACACAGGG + Intronic
1135672983 16:24390790-24390812 CAGCCAAAGTTGGGGATAACTGG - Intergenic
1136767336 16:32795720-32795742 GAGCCACAGATGATGATAATGGG + Intergenic
1136800812 16:33074981-33075003 GAGCCACAGATGATGATAATGGG - Intergenic
1137777943 16:51071991-51072013 TAGCAGCAGCTGGTGGTTACTGG + Intergenic
1138720439 16:59073102-59073124 CAGCCACTGCTGCTGATACCCGG + Intergenic
1141063608 16:80896902-80896924 TTGCCACAGCTGGGGACAAGGGG - Intergenic
1141568584 16:84920449-84920471 CAGCCACAGCTGGTCTTCACTGG + Intronic
1144452762 17:15394902-15394924 TAGCCACTGGTGGTGAGGACAGG - Intergenic
1150160783 17:62896048-62896070 TAGCCACAGCTATGGACAACTGG - Intergenic
1152059676 17:78062197-78062219 TAGCAATTGCTGGCGATAACTGG + Intronic
1153829534 18:8909734-8909756 CAGCAACAGCTGGAGATCACTGG - Intergenic
1154243535 18:12674690-12674712 AAGCCAAAGCTGGTGATAAAAGG + Exonic
1157082964 18:44548328-44548350 TAACCACAGTTGGACATAACAGG - Intergenic
1157318227 18:46611250-46611272 TAGCCACAGCAGTTGGTAAAGGG + Intronic
1157331865 18:46710099-46710121 TAGTCCCAGCGGGTGATATCAGG + Intronic
1157348791 18:46865932-46865954 TAGCCACAGATAGTGAAAAGTGG - Intronic
1158398946 18:57103767-57103789 CAGCCTCTGCTGGAGATAACTGG - Intergenic
1158609722 18:58928182-58928204 CAGCCCCAGCTGGTGCTCACAGG - Intronic
1158653643 18:59308984-59309006 TAGCCACAGCTGGTGATAACTGG + Intronic
1160149633 18:76389200-76389222 GAGCCACAGCTGGCAACAACTGG + Intronic
1162396816 19:10421866-10421888 TAGCCACAGCTGGTCATACCCGG - Intronic
1163866064 19:19774478-19774500 TAGCCACAGCTGGTGTTCACAGG - Intergenic
1164466406 19:28490897-28490919 TAGACACAGCTGCAGATAGCAGG + Intergenic
1168298790 19:55391271-55391293 TCCCCACAGCTGGGCATAACTGG - Intronic
926943887 2:18167502-18167524 CAGCCTCTGCTGGTGATACCCGG - Intronic
931606468 2:64058094-64058116 TAGGGACAGGTGGTGATAAGGGG - Intergenic
931986116 2:67744272-67744294 CAGCCTCTGCTGGTGATACCCGG - Intergenic
937983844 2:127629812-127629834 TCGGCACAGCTGCTGGTAACTGG + Exonic
938421498 2:131150896-131150918 TCGCCTCAGCTGCTGATAACAGG + Intronic
940925261 2:159356806-159356828 CAGCCTCCGCTGGTGATAACAGG + Intronic
945139687 2:206671210-206671232 TAGCCACAGCTGTTTATAAATGG - Intronic
945979237 2:216295795-216295817 TAGCCACACCTGGAGACAACTGG - Intronic
947818238 2:233052396-233052418 TACCTACTGTTGGTGATAACTGG - Intergenic
1169012899 20:2265284-2265306 CAGCCTCTGCTGGTGATACCAGG + Intergenic
1172028274 20:31964395-31964417 TGGCCACAGCTGGTCAGAACTGG - Intergenic
1172458212 20:35094184-35094206 ATTCAACAGCTGGTGATAACTGG + Intergenic
1177651943 21:23968867-23968889 CAGCTACAGCTGGTGAACACAGG - Intergenic
1183192992 22:36333800-36333822 AAGCCAGAGCTGGAGAGAACAGG + Intronic
1184264327 22:43339010-43339032 CAGCCCCAGCTGGTGATGAATGG + Intronic
953337357 3:42104553-42104575 CAGCCTCCGCTGGTGATACCCGG + Intronic
953901266 3:46845515-46845537 CAGCCACAGCTGGCGATTTCGGG + Intergenic
956901988 3:73726551-73726573 TAGCCACATCTGCTGATAAAAGG - Intergenic
959332162 3:105020298-105020320 TAGCTACAGTTAGTGATAATTGG + Intergenic
962375831 3:134857966-134857988 GACCCACAGCTTGTGGTAACAGG - Intronic
966734077 3:183175191-183175213 CAGTCACAGCTGGTGATGTCCGG + Intergenic
970444784 4:16114657-16114679 TAGCCTCAGCTGGTGACAGCTGG - Intergenic
970549952 4:17169612-17169634 TAGACAAAGCTGGTAAGAACCGG + Intergenic
972337128 4:38117156-38117178 GAGCCACAGCTGGTGCTTATGGG + Intronic
985898274 5:2763607-2763629 AAGCCCCAGCTGGTGTTAACAGG - Intergenic
987453028 5:18109767-18109789 TATCCACTGCTGGTGAGAAAGGG - Intergenic
991199933 5:63980199-63980221 CAGCCTCTGCTGGTGATACCCGG - Intergenic
992208733 5:74456416-74456438 TAGCCACACCTGCTTCTAACAGG + Intergenic
994274647 5:97821716-97821738 TAGCCACAGTAGAAGATAACAGG - Intergenic
998920839 5:147065985-147066007 GACCCACACCTGGTAATAACAGG + Intronic
998972684 5:147610493-147610515 CAGCCTCTGCTGGTGATAACCGG - Intronic
999322122 5:150621955-150621977 AAGTCTCAGCTGGTCATAACTGG + Intronic
1000145108 5:158446518-158446540 TAGCCTCTGCTGGAGATACCCGG - Intergenic
1000176917 5:158765581-158765603 TAACCACAGTTGATGTTAACAGG + Intronic
1003472901 6:6453123-6453145 TATCCACAACCGGTGAAAACTGG - Intergenic
1006569566 6:34990382-34990404 TATCCAGAGGTGGTAATAACAGG - Intronic
1008016547 6:46526723-46526745 TGGCCACAGCTGGGGACAAAAGG + Intergenic
1011174191 6:84541644-84541666 CAGCCTCAGCTGGTGATACCTGG + Intergenic
1011848064 6:91590791-91590813 CAGCCTCTGCTGGTGATACCAGG + Intergenic
1012306351 6:97662922-97662944 TACCCACAGCTTGTGATATCTGG + Intergenic
1012994557 6:105960425-105960447 AAGCCACAGCTGGTGTCCACTGG + Intergenic
1013628325 6:111959588-111959610 TAGCCAAAGCTAGTGAGAACTGG - Intergenic
1014070466 6:117175703-117175725 CAGCCTCTGCTGGTGATACCTGG + Intergenic
1014584690 6:123183268-123183290 CAGCCTCCACTGGTGATAACCGG + Intergenic
1019203566 6:170340797-170340819 CAGCCTCCGCTGGTGATACCAGG - Intronic
1022081898 7:27030663-27030685 TTGCTCCAGCTGGTGGTAACAGG + Intergenic
1024807443 7:53160948-53160970 GAGCCACAGATGATGATAATGGG + Intergenic
1027275798 7:76553982-76554004 TACACAGAGCTGGTGATAGCAGG - Intergenic
1029557282 7:101279194-101279216 CAGCCATTGCTGGTGCTAACAGG - Intergenic
1032312493 7:130801838-130801860 CAGCCTCTGCTGGTGATACCAGG - Intergenic
1037085805 8:14848225-14848247 AAGCCATAGCTGGTGTTAATGGG + Intronic
1037581419 8:20247914-20247936 TAGCCACAGCTGCTGTTCTCAGG - Exonic
1038709900 8:29933841-29933863 TAGCCATAGCTGATGAGAAATGG + Intergenic
1042042068 8:64602589-64602611 AAGCCTCAGATGTTGATAACAGG - Intronic
1042226866 8:66521096-66521118 TACCCACAGCTGCTGATCCCTGG - Intergenic
1050178921 9:2899330-2899352 CAGCCACCGCTGCTGATACCAGG - Intergenic
1050879855 9:10685596-10685618 TGGCAACAGCTAGTGATAGCTGG - Intergenic
1053608072 9:39680698-39680720 CAGCCTCCGCTGGTGATACCTGG - Intergenic
1053865915 9:42437058-42437080 CAGCCTCCGCTGGTGATACCTGG - Intergenic
1054245460 9:62661711-62661733 CAGCCTCCGCTGGTGATACCTGG + Intergenic
1054559588 9:66696242-66696264 CAGCCTCCGCTGGTGATACCTGG + Intergenic
1057389266 9:94629362-94629384 TAGGCACAGCTGTTGATATGGGG + Intronic
1061398497 9:130355975-130355997 GAGCCACGGCTGGTGAGAGCAGG + Intronic
1061486580 9:130923473-130923495 GAGCCACAGCTGGGGATCTCAGG + Intronic
1061939277 9:133875357-133875379 TATCCACAGCTGATGGGAACAGG + Intronic
1188343920 X:29040532-29040554 TAGTTGCAGCTGGTGAAAACTGG - Intronic
1191232607 X:58107839-58107861 TAGAGACAGCTGGTGATCTCAGG + Intergenic
1192810872 X:74546301-74546323 TGGTCACAGCTGGTTAAAACTGG - Intergenic
1192810932 X:74546820-74546842 CAGCCACGGCTGGTTAAAACTGG - Intergenic
1192936973 X:75870537-75870559 TAGCCACAGCTGGAGATGGAGGG - Intergenic
1193071976 X:77315508-77315530 CAGCCACCGCTGGTAATATCAGG + Intergenic
1195965063 X:110422469-110422491 TTGCCACAACTGGGGAGAACAGG - Intronic
1199635087 X:149806377-149806399 TAGCCACACCTGGTCAGCACAGG + Intergenic
1199673307 X:150164390-150164412 TAGCCACTGCAGGAGAAAACTGG - Intergenic
1199947612 X:152680971-152680993 TAGCCACACCTGGTCAGCACCGG + Intergenic
1199962067 X:152787483-152787505 TAGCCACACCTGGTCAGCACCGG - Intergenic
1200321942 X:155198469-155198491 CAGCCACTGCTGCTGATACCAGG + Intronic