ID: 1158654406

View in Genome Browser
Species Human (GRCh38)
Location 18:59316770-59316792
Sequence ATAGATGCCTTATCTGCAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158654404_1158654406 19 Left 1158654404 18:59316728-59316750 CCAGATATAAAATTAAGGAAAAC 0: 1
1: 0
2: 2
3: 39
4: 520
Right 1158654406 18:59316770-59316792 ATAGATGCCTTATCTGCAATCGG 0: 1
1: 0
2: 3
3: 12
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158654406 Original CRISPR ATAGATGCCTTATCTGCAAT CGG Intronic
903308472 1:22432216-22432238 ATGGATGGCTTCTCTGCAAAAGG + Intergenic
903395674 1:23000156-23000178 TTAGCTGTCTTATCAGCAATGGG + Intergenic
904649632 1:31995096-31995118 ATAAACTCCTTATCTGCCATTGG + Intergenic
907584165 1:55601348-55601370 AAAGAGGCATTATCTGCAATGGG - Intergenic
909106065 1:71410546-71410568 CTAGATTACTTATCTGCCATAGG - Intronic
909894947 1:81057219-81057241 AAAATTACCTTATCTGCAATGGG - Intergenic
910245850 1:85137126-85137148 TTAGATGCCTTGTCTGTAAATGG + Intergenic
913518680 1:119625434-119625456 TGAGATGACTTATCTGCAAAGGG + Intronic
917042593 1:170822551-170822573 ATTTATGTCTGATCTGCAATTGG - Intergenic
920908683 1:210194014-210194036 ATAGAGGGCTTATCAGTAATGGG - Intergenic
923634061 1:235677276-235677298 ATGTATGCCTTATGTACAATAGG - Intronic
1063882577 10:10546300-10546322 ATACATGCCTTATCAGAATTCGG - Intergenic
1067919866 10:50443190-50443212 AGGGATGCCTTATCTACATTAGG - Intronic
1067969495 10:50953734-50953756 ATAGATGTATTAGCTCCAATGGG - Intergenic
1070492927 10:76994191-76994213 TTAGTTGCCTTATCTGTAAATGG + Intronic
1075480440 10:122776958-122776980 ATAGATGCACTATTTGCAGTTGG - Intergenic
1078417287 11:11176183-11176205 ATATATACCTTATCAGCTATAGG + Intergenic
1078899030 11:15624054-15624076 ATAGATCCCTTATCTGCCATTGG - Intergenic
1079131466 11:17749304-17749326 AAAGATGCCTTATCTGCAAGAGG - Intronic
1080327448 11:31093901-31093923 ATAGATGCCATCTCTGCCGTTGG - Intronic
1081348526 11:42020084-42020106 ATAGAGGCATTTTCTGAAATGGG + Intergenic
1081655098 11:44851786-44851808 ATGGGTGGCTTAGCTGCAATGGG - Intronic
1083988803 11:66233988-66234010 ACAGATGCCTCATCTGGAACAGG + Intronic
1088099181 11:106135607-106135629 ATATATGCATTATCTGGCATAGG + Intergenic
1088222211 11:107581165-107581187 ATAGTTGTCTTATCTGGTATTGG + Intergenic
1090552412 11:127837174-127837196 ATAGATGACTGATCTGTAATGGG - Intergenic
1093008467 12:14078251-14078273 AAAGATGTATTATATGCAATTGG + Intergenic
1093323395 12:17742025-17742047 ATAGATGCTTTGCCTGCAGTGGG - Intergenic
1096289617 12:50330678-50330700 ATAGATGTCTTCTCTGCTATTGG + Exonic
1096577818 12:52565115-52565137 AGAGATGCTTAATCTGCAGTGGG - Intergenic
1098395441 12:70011809-70011831 ATCTAAGCCTTATCTGCATTAGG - Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1099474863 12:83095754-83095776 ATAGATGGCTTACATGCAAATGG - Intronic
1100589580 12:96013547-96013569 ATTGATGACTTCTCTGAAATAGG + Intronic
1101162483 12:101993520-101993542 ATCTAAGCCTTATCTGCATTAGG + Intronic
1101772439 12:107763576-107763598 ATAGCTGCGTTATCTGTCATAGG + Intergenic
1106818715 13:33439304-33439326 ATATATGCCTTATTTTCAAGAGG + Intergenic
1108987624 13:56613069-56613091 ATAGGTGCATTTTCTGCCATAGG + Intergenic
1109223488 13:59664607-59664629 GTAGATGCCCTTTCAGCAATGGG - Intergenic
1109516305 13:63446752-63446774 ATATATCCCCTAGCTGCAATAGG - Intergenic
1112182310 13:97095810-97095832 GTGGAAGCCTTATCTGTAATAGG - Intergenic
1118026548 14:61774592-61774614 ATATATGCAGGATCTGCAATGGG - Intronic
1118773564 14:68958683-68958705 ATAGAGGCATTATCTACGATAGG + Intronic
1123662259 15:22574887-22574909 TTGTATGCCTTATCTGCATTTGG + Intergenic
1128164009 15:65445372-65445394 ATAGATGCCTTCCCTGCCACTGG + Exonic
1128381544 15:67116791-67116813 ATAGATGACTTCTCAGCCATTGG + Intronic
1129257869 15:74344310-74344332 AGAGATTCCTCATCTGTAATTGG + Intronic
1133422658 16:5660113-5660135 ACAAATGCCTTGTCTGCATTTGG + Intergenic
1135378665 16:21974112-21974134 ATTGAAGCATTATCTGCTATAGG + Intronic
1135781407 16:25304808-25304830 ACAGATACCTTACTTGCAATAGG + Intergenic
1139190018 16:64852083-64852105 ATAGCAGCCTTATTTGCAATAGG - Intergenic
1139211568 16:65082896-65082918 ATTGATGCTTTACCTGTAATAGG + Intronic
1149142688 17:53453144-53453166 ATAGATTCATTTTCTGCAGTGGG + Intergenic
1149180516 17:53931380-53931402 ATATAAGCCATATCTGCATTAGG + Intergenic
1155776213 18:29765386-29765408 ATAGAATCCTTATCTTCATTTGG + Intergenic
1155873675 18:31058302-31058324 TTAGATGCCTTATGTGCATGGGG - Intergenic
1155909673 18:31493732-31493754 ATAGCTGCCTTTTCAGCAATAGG - Intergenic
1158140007 18:54245481-54245503 AAAGATTCCTCCTCTGCAATGGG + Intergenic
1158221174 18:55152193-55152215 ATTTATGCTTTATTTGCAATCGG + Intergenic
1158583764 18:58709972-58709994 ATAGGTGCCTTATGTGGATTTGG + Exonic
1158654406 18:59316770-59316792 ATAGATGCCTTATCTGCAATCGG + Intronic
1164405317 19:27939284-27939306 ACAGAGGCCTTATCTGTATTTGG - Intergenic
1164960692 19:32426887-32426909 AAAAATGCATTATCTGCAAAGGG + Intronic
1167732395 19:51268097-51268119 ACAGATGGCTTATCTACAAAAGG - Intronic
925766945 2:7245332-7245354 ATGTATGGCTTATCTGCGATAGG + Intergenic
927608280 2:24509375-24509397 ATAGCTGCCTTATCTACTTTGGG + Intronic
928454197 2:31404534-31404556 AGAAATTCCTTATCAGCAATTGG - Intronic
933098011 2:78211699-78211721 ATTGCTGCCCTATCTGCATTAGG - Intergenic
933177632 2:79193638-79193660 AGAGATGCCCTATTTGAAATTGG - Intronic
933237235 2:79878475-79878497 ATAGATGCTATAGATGCAATTGG - Intronic
937604723 2:123785181-123785203 ATAGATGCCTGAACTGCAAAGGG - Intergenic
937860773 2:126707314-126707336 ATAGATGCCAGCTCTGCAAATGG - Intergenic
938629997 2:133156130-133156152 ATAGATGGCACATCTGAAATAGG - Intronic
941725899 2:168860019-168860041 ACTGATGCATTATCTGCATTAGG - Intronic
1171227675 20:23455012-23455034 ATTTTTGCCTTATCTGCCATTGG + Intergenic
1174588213 20:51625060-51625082 AGGAGTGCCTTATCTGCAATGGG - Intronic
1175560702 20:59926824-59926846 ATTGCTGCCTTATGTGCAAGGGG - Intronic
1175568367 20:59999103-59999125 ATAGATGCCTTCCCTGCATGTGG + Intronic
1175580627 20:60096084-60096106 ATACATGGCTGAGCTGCAATGGG - Intergenic
1175905221 20:62376332-62376354 ATCCCTGCCTTATCTGCAAGTGG + Intergenic
1179006970 21:37523632-37523654 GCTGATGCCTAATCTGCAATGGG - Intergenic
1179173839 21:38992836-38992858 ATAGATGTTTTATATCCAATGGG - Intergenic
949853087 3:8438558-8438580 ATAGGTGCCTGATATGCAGTGGG + Intergenic
961192730 3:124975744-124975766 TTATATGACTTATCTGAAATAGG - Intronic
961496082 3:127292549-127292571 ATTGATGCATTTTTTGCAATGGG - Intergenic
962050130 3:131804842-131804864 AGCGAGGCCTTATCTGCAGTTGG + Intronic
962078603 3:132113713-132113735 ATATAAGCCATATCTGCATTAGG + Intronic
962139966 3:132779687-132779709 ATGAATGCTTTATCTGCCATGGG + Intergenic
964030548 3:152133985-152134007 ATAGAGGCTTTATTTGCAATAGG + Intergenic
966455474 3:180110688-180110710 AAAGATGGCAAATCTGCAATGGG + Intergenic
970006073 4:11412087-11412109 ATAGAAGCTTTATCAGCTATTGG - Intronic
971495859 4:27264509-27264531 ACAGATGCCCTTTCTGCCATGGG - Intergenic
972137650 4:35911982-35912004 AGAGCTGGCTTAGCTGCAATAGG - Intergenic
973054045 4:45631437-45631459 ATATAAGCCTTATCAGCATTAGG - Intergenic
973693141 4:53461347-53461369 ATACATGCCTTATCTCAAATGGG + Intronic
974144093 4:57924515-57924537 ATAGCTCCTTTATCTTCAATTGG + Intergenic
978048531 4:104165821-104165843 ATAAATGCCTTATCTTAGATGGG + Intergenic
980390706 4:132142729-132142751 ATAGAGGTTTCATCTGCAATTGG - Intergenic
983232443 4:165142703-165142725 AAAGATTCTTTATCTGGAATAGG + Intronic
986806783 5:11314797-11314819 ATGAATGTCTTAGCTGCAATGGG + Intronic
987509015 5:18811563-18811585 AAAGATGCTTTAAGTGCAATTGG - Intergenic
988340248 5:29961053-29961075 ATCTAGGCCTTATCTGCATTGGG - Intergenic
988651708 5:33159064-33159086 TTAGATGCCTGATATGCAATAGG + Intergenic
989832279 5:45935024-45935046 ATAGAGGCCTTTTATGAAATAGG + Intergenic
993343967 5:86759385-86759407 ATAAATGCTTTTTCTGAAATAGG - Intergenic
993990816 5:94656056-94656078 ATAGCTACCTTATGTGAAATGGG - Intronic
997059249 5:130480411-130480433 ATAGCAGCTTTATCTGTAATTGG - Intergenic
997458897 5:134038986-134039008 ATAGACACTTTATTTGCAATAGG + Intergenic
998906458 5:146910541-146910563 TTAGTTGCCTCATCTGCAAAAGG + Intronic
1000170472 5:158698046-158698068 ATAGAGGCAGTATCTGGAATGGG + Exonic
1000559241 5:162765507-162765529 ATATTTCCCTTACCTGCAATCGG + Intergenic
1000699633 5:164432675-164432697 ATAGATGAATTATCTGCAATTGG - Intergenic
1005249010 6:23922863-23922885 TTAATTGCCTTATTTGCAATGGG - Intergenic
1008883339 6:56404903-56404925 ACATATGCATTATCTGCAATTGG - Intergenic
1009331192 6:62422811-62422833 ATTTATGCCTAATCTGCCATTGG + Intergenic
1010448733 6:75978481-75978503 TTAGATGCTTCATCTGCAAATGG - Intronic
1012293706 6:97493329-97493351 AAAGATGCCCTAGCTGAAATAGG - Intergenic
1015047360 6:128792028-128792050 ATAGATGCCTTATCTGTTTGAGG + Intergenic
1016061452 6:139635602-139635624 ATCGAAGCCATATCTGCATTAGG + Intergenic
1023031192 7:36091859-36091881 AAAGAAGCCTTGTCTGCTATTGG - Intergenic
1028192571 7:87869764-87869786 ATAGTTGCTTTATTTGTAATAGG - Intronic
1030703826 7:112670022-112670044 ATATATGCATTATCTCCCATTGG + Intergenic
1032831381 7:135630559-135630581 ATATATGACTTATTTGAAATTGG + Intronic
1033825845 7:145187844-145187866 AAAGATTCCATATTTGCAATGGG + Intergenic
1034907527 7:154963823-154963845 ATAGCTGCCTTATTTGAAATTGG - Intronic
1038531563 8:28321967-28321989 GTAGGAGTCTTATCTGCAATGGG + Intronic
1039872342 8:41557183-41557205 AAAGAAGCCTTTTCTGCACTAGG - Intergenic
1042586468 8:70344648-70344670 ATAGATGGCTTCTCTGGACTAGG + Intronic
1042890551 8:73604971-73604993 ACAGATGCATTATTTGAAATAGG + Intronic
1043562590 8:81511720-81511742 ATAGCTGCTTTATTTGCAATAGG + Intergenic
1044153823 8:88817768-88817790 ATAGATTCCATATTGGCAATTGG + Intergenic
1046793076 8:118342410-118342432 AAAGATCCCTTATCTACGATTGG - Intronic
1048734285 8:137481256-137481278 ATAGATGCCCAATATGCCATGGG + Intergenic
1049342889 8:142123241-142123263 ATGGATGTCTTCTCTGCACTGGG + Intergenic
1050294484 9:4191422-4191444 ATAAATACCTCATCTGCAAGAGG + Intronic
1051443920 9:17120082-17120104 ATAGCAGCATTATATGCAATAGG + Intergenic
1051936186 9:22446359-22446381 AAAGATGCCTTATTTTAAATGGG - Intergenic
1053169857 9:35870830-35870852 ATAGAACACTTATCTGCAGTAGG - Intergenic
1055360589 9:75485720-75485742 AAAAATGCCTTATATACAATAGG - Intergenic
1056297298 9:85205811-85205833 ATAGATGCTTCATCTACGATGGG - Intergenic
1058112400 9:101045494-101045516 CTAGATGCCTAATTGGCAATAGG + Intronic
1059397081 9:114042140-114042162 ATAAATGCATTCTCTGCATTGGG + Intronic
1185966852 X:4615279-4615301 ATAGATGGCATTTCTGAAATTGG - Intergenic
1191869102 X:65730461-65730483 ATATATGCCATAACTCCAATGGG - Intronic
1197452559 X:126638147-126638169 AAAGGTGCCTTCTGTGCAATCGG + Intergenic
1201219491 Y:11754493-11754515 TTAGAGGCCTTATCTCCAAAAGG + Intergenic